ID: 1169331262

View in Genome Browser
Species Human (GRCh38)
Location 20:4718169-4718191
Sequence CCCAGCCGCGAGTCTCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169331262_1169331268 10 Left 1169331262 20:4718169-4718191 CCACATGGAGACTCGCGGCTGGG No data
Right 1169331268 20:4718202-4718224 GAAGAGTGGGCAAACCGTAAAGG No data
1169331262_1169331269 13 Left 1169331262 20:4718169-4718191 CCACATGGAGACTCGCGGCTGGG No data
Right 1169331269 20:4718205-4718227 GAGTGGGCAAACCGTAAAGGAGG No data
1169331262_1169331266 -4 Left 1169331262 20:4718169-4718191 CCACATGGAGACTCGCGGCTGGG No data
Right 1169331266 20:4718188-4718210 TGGGTTTGGGAGCAGAAGAGTGG No data
1169331262_1169331267 -3 Left 1169331262 20:4718169-4718191 CCACATGGAGACTCGCGGCTGGG No data
Right 1169331267 20:4718189-4718211 GGGTTTGGGAGCAGAAGAGTGGG No data
1169331262_1169331270 14 Left 1169331262 20:4718169-4718191 CCACATGGAGACTCGCGGCTGGG No data
Right 1169331270 20:4718206-4718228 AGTGGGCAAACCGTAAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169331262 Original CRISPR CCCAGCCGCGAGTCTCCATG TGG (reversed) Intergenic