ID: 1169332185

View in Genome Browser
Species Human (GRCh38)
Location 20:4724724-4724746
Sequence CTTGCGGCCTTGCTTGATGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169332185_1169332192 20 Left 1169332185 20:4724724-4724746 CCTTCATCAAGCAAGGCCGCAAG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1169332192 20:4724767-4724789 CGAGGGCAACAGGTACTACGAGG 0: 1
1: 0
2: 1
3: 3
4: 34
1169332185_1169332190 10 Left 1169332185 20:4724724-4724746 CCTTCATCAAGCAAGGCCGCAAG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1169332190 20:4724757-4724779 ACTTCGGAGCCGAGGGCAACAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1169332185_1169332187 -6 Left 1169332185 20:4724724-4724746 CCTTCATCAAGCAAGGCCGCAAG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1169332187 20:4724741-4724763 CGCAAGCTCGACATTGACTTCGG 0: 1
1: 0
2: 0
3: 1
4: 38
1169332185_1169332188 2 Left 1169332185 20:4724724-4724746 CCTTCATCAAGCAAGGCCGCAAG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1169332188 20:4724749-4724771 CGACATTGACTTCGGAGCCGAGG 0: 1
1: 0
2: 0
3: 2
4: 17
1169332185_1169332189 3 Left 1169332185 20:4724724-4724746 CCTTCATCAAGCAAGGCCGCAAG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1169332189 20:4724750-4724772 GACATTGACTTCGGAGCCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169332185 Original CRISPR CTTGCGGCCTTGCTTGATGA AGG (reversed) Exonic
900524820 1:3123462-3123484 CCTGCGGCCTTCCTGGAGGAGGG + Intronic
901789721 1:11647844-11647866 CTAGGGGCCCAGCTTGATGAAGG + Intergenic
1067159721 10:43815041-43815063 TTTGCGGCATTGCTTGCTTATGG + Intergenic
1068949671 10:62764515-62764537 ATTTCAGCCTTGCTTGATCAGGG - Intergenic
1069090615 10:64195680-64195702 CTTGCTGCCTCCCTGGATGAGGG - Intergenic
1070537410 10:77390066-77390088 CTTGTGGCCTTTGCTGATGAAGG + Intronic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1083721129 11:64604026-64604048 CCAGGGGGCTTGCTTGATGAGGG + Intergenic
1088803679 11:113331271-113331293 TTTGTCGCCTTGCTTGATAATGG + Intronic
1090114904 11:123958744-123958766 TTTGATGCCTTGCTTGTTGAGGG + Intergenic
1091920815 12:4303217-4303239 CTTGGGGCCTTGTGTGATGATGG + Exonic
1092704286 12:11267321-11267343 CTTGTGGCCTTCCTGGAGGAGGG + Exonic
1112156715 13:96825136-96825158 TTTGCTGCTTTGCTTTATGAGGG + Intronic
1112409696 13:99152243-99152265 CTTGAAGCCTTTGTTGATGAAGG + Intergenic
1117634398 14:57726317-57726339 CTTGCTGAGGTGCTTGATGAAGG + Intronic
1117658970 14:57984721-57984743 CCTGGGGCCTTGCTGGATGTCGG + Intergenic
1118848859 14:69569921-69569943 CTTCCCACCTTCCTTGATGAAGG + Exonic
1118876942 14:69793898-69793920 CTAGTGGCCTTCCTTGAGGAGGG + Intronic
1119751238 14:77079059-77079081 CATGGTGTCTTGCTTGATGATGG - Intergenic
1121809022 14:96863036-96863058 TTTGCAGCCATGCTTGATTATGG + Intronic
1123833048 15:24161459-24161481 CTTGCTTCCTTGTTTGGTGAAGG - Intergenic
1128082657 15:64865586-64865608 CTTGGGGACTTGCTTGGGGAAGG + Exonic
1131911567 15:97210415-97210437 CTTGCTGGCTTGCTTGCTTATGG - Intergenic
1138895997 16:61205566-61205588 CTTGTGGCCTTACTAGAAGAGGG - Intergenic
1140208226 16:72950616-72950638 CTTGCCGCCCTCCTTGATGTGGG + Exonic
1147378057 17:40034799-40034821 CTAGCAGCTATGCTTGATGAGGG + Intronic
1150162232 17:62908150-62908172 CTGGCTGCATTCCTTGATGAAGG + Intergenic
1152705979 17:81843914-81843936 CCTGCGGCCTCGCTTGAAGGAGG - Exonic
1153342448 18:3989167-3989189 CTTGCGTCCTTGCTGGTGGACGG + Intronic
1158666781 18:59439686-59439708 CCTCCGGCCTTGCTTAATGTGGG + Exonic
931485670 2:62688925-62688947 CTTCTGGCTTTGCTTCATGAAGG + Intronic
935796930 2:106651675-106651697 CCTGTAGACTTGCTTGATGAAGG + Intergenic
935889418 2:107659667-107659689 GTAGCGGGCTTGCTTGATGTTGG - Intergenic
939788330 2:146543288-146543310 GTTGCGACCTTGATTGATGCAGG - Intergenic
945056992 2:205877996-205878018 CTTGCTGCCTTGCTTTACCATGG - Intergenic
948106415 2:235417721-235417743 CTTGCGTCCTGGCTTGGTGATGG - Intergenic
1169332185 20:4724724-4724746 CTTGCGGCCTTGCTTGATGAAGG - Exonic
1171402934 20:24891106-24891128 CTTGCAGCCTTTCTAGCTGAGGG - Intergenic
1171486327 20:25489114-25489136 CTTGCGGCCATGCTTGACCATGG - Intronic
1179228353 21:39476574-39476596 CTTGCGTCCCTGCTTGCTGCCGG + Intronic
1179595653 21:42441490-42441512 CTTGGGGGCCTGGTTGATGAAGG + Intronic
1179642983 21:42759335-42759357 CATGCTGCTTTGCTTGATGATGG - Intronic
1181531069 22:23517808-23517830 CTGGCGGCCTTGGCTGAGGAAGG + Intergenic
955495669 3:59529616-59529638 CTGGCTGCCTTGCTGGGTGATGG - Intergenic
963475488 3:145798525-145798547 CTTCCTGCCTTGCTTGTTGTTGG + Intergenic
967216899 3:187218839-187218861 CTTATGGCCTTGCAAGATGAGGG + Intronic
968726300 4:2249321-2249343 GTTGCGTCCTTGTTTGCTGAGGG - Exonic
971114168 4:23624349-23624371 CTTGAGGGTTTTCTTGATGAAGG - Intergenic
980988673 4:139719306-139719328 CTTGGGGCCTCTCTTGATTAGGG + Exonic
987302684 5:16610353-16610375 CCTGTGGCATTGCATGATGATGG - Intronic
1003661297 6:8064562-8064584 CTTGCCGCCATGCTGGATCAGGG + Intronic
1022335500 7:29417916-29417938 CTAGGGGCCTGGCTTGAAGATGG + Intronic
1024707114 7:51972692-51972714 CTTACGGCCTTGCAGGATGTTGG - Intergenic
1024732391 7:52267248-52267270 TCTGCTGCCTTTCTTGATGATGG - Intergenic
1026369497 7:69684358-69684380 CTTGCTGCCCTGGTTCATGAGGG + Intronic
1027860425 7:83571539-83571561 CTTGCTGCCTGGTTTGTTGAGGG - Intronic
1036606333 8:10308806-10308828 CTTGCAGTCTTGCCTGATGTTGG - Intronic
1037138802 8:15495498-15495520 CTTGGGGCCTTGCTAGAGGTAGG - Intronic
1038790847 8:30666953-30666975 ATTGCGGACTTTCTTGAAGAGGG + Intergenic
1038896275 8:31786250-31786272 CTTAGGCCCTGGCTTGATGAAGG + Intronic
1043257915 8:78158667-78158689 TTTCTGGCCTTGCTAGATGAAGG - Intergenic
1047658733 8:127008977-127008999 CTTCAGGCCCTGCTTGATGAAGG + Intergenic
1050061438 9:1713644-1713666 ATTCTTGCCTTGCTTGATGAAGG - Intergenic
1054861434 9:69957917-69957939 CTTGCAACCTTGCTTCTTGACGG + Intergenic
1186944759 X:14553496-14553518 CTTTCTGCCTTGATAGATGATGG + Intronic
1189324475 X:40104672-40104694 CTTGCAGCCTGGCTTGGAGACGG - Intronic
1192941856 X:75920934-75920956 CTTGGGGCCTTGCCTGCTGAAGG - Intergenic
1196674983 X:118410226-118410248 TTTGCAGCCTTACTTGATGGCGG - Intronic
1198101076 X:133422312-133422334 CTTGAGGCCTTGTGGGATGAAGG + Intergenic