ID: 1169332723

View in Genome Browser
Species Human (GRCh38)
Location 20:4729481-4729503
Sequence GATCACTCGCCTGGCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169332723_1169332726 -4 Left 1169332723 20:4729481-4729503 CCACACCTGCCAGGCGAGTGATC No data
Right 1169332726 20:4729500-4729522 GATCAAGACTTACACAGACATGG No data
1169332723_1169332727 23 Left 1169332723 20:4729481-4729503 CCACACCTGCCAGGCGAGTGATC No data
Right 1169332727 20:4729527-4729549 ATGACCAGTTTCAGTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169332723 Original CRISPR GATCACTCGCCTGGCAGGTG TGG (reversed) Intergenic
No off target data available for this crispr