ID: 1169332724

View in Genome Browser
Species Human (GRCh38)
Location 20:4729486-4729508
Sequence GTCTTGATCACTCGCCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169332724_1169332726 -9 Left 1169332724 20:4729486-4729508 CCTGCCAGGCGAGTGATCAAGAC No data
Right 1169332726 20:4729500-4729522 GATCAAGACTTACACAGACATGG No data
1169332724_1169332727 18 Left 1169332724 20:4729486-4729508 CCTGCCAGGCGAGTGATCAAGAC No data
Right 1169332727 20:4729527-4729549 ATGACCAGTTTCAGTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169332724 Original CRISPR GTCTTGATCACTCGCCTGGC AGG (reversed) Intergenic
No off target data available for this crispr