ID: 1169332727

View in Genome Browser
Species Human (GRCh38)
Location 20:4729527-4729549
Sequence ATGACCAGTTTCAGTTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169332724_1169332727 18 Left 1169332724 20:4729486-4729508 CCTGCCAGGCGAGTGATCAAGAC No data
Right 1169332727 20:4729527-4729549 ATGACCAGTTTCAGTTTTTCTGG No data
1169332723_1169332727 23 Left 1169332723 20:4729481-4729503 CCACACCTGCCAGGCGAGTGATC No data
Right 1169332727 20:4729527-4729549 ATGACCAGTTTCAGTTTTTCTGG No data
1169332725_1169332727 14 Left 1169332725 20:4729490-4729512 CCAGGCGAGTGATCAAGACTTAC No data
Right 1169332727 20:4729527-4729549 ATGACCAGTTTCAGTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169332727 Original CRISPR ATGACCAGTTTCAGTTTTTC TGG Intergenic
No off target data available for this crispr