ID: 1169334105

View in Genome Browser
Species Human (GRCh38)
Location 20:4740878-4740900
Sequence TTTCCTTGCGGGGGGCCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169334095_1169334105 23 Left 1169334095 20:4740832-4740854 CCCTGAGGAGAGCGTCTCAGCCA 0: 1
1: 0
2: 1
3: 7
4: 108
Right 1169334105 20:4740878-4740900 TTTCCTTGCGGGGGGCCCGCTGG No data
1169334096_1169334105 22 Left 1169334096 20:4740833-4740855 CCTGAGGAGAGCGTCTCAGCCAA 0: 1
1: 0
2: 1
3: 10
4: 94
Right 1169334105 20:4740878-4740900 TTTCCTTGCGGGGGGCCCGCTGG No data
1169334099_1169334105 -10 Left 1169334099 20:4740865-4740887 CCTCTAGCTCAAGTTTCCTTGCG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1169334105 20:4740878-4740900 TTTCCTTGCGGGGGGCCCGCTGG No data
1169334098_1169334105 -3 Left 1169334098 20:4740858-4740880 CCAACTGCCTCTAGCTCAAGTTT 0: 1
1: 0
2: 0
3: 20
4: 157
Right 1169334105 20:4740878-4740900 TTTCCTTGCGGGGGGCCCGCTGG No data
1169334094_1169334105 27 Left 1169334094 20:4740828-4740850 CCTTCCCTGAGGAGAGCGTCTCA 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1169334105 20:4740878-4740900 TTTCCTTGCGGGGGGCCCGCTGG No data
1169334097_1169334105 3 Left 1169334097 20:4740852-4740874 CCAAATCCAACTGCCTCTAGCTC 0: 1
1: 0
2: 0
3: 13
4: 203
Right 1169334105 20:4740878-4740900 TTTCCTTGCGGGGGGCCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169334105 Original CRISPR TTTCCTTGCGGGGGGCCCGC TGG Intergenic
No off target data available for this crispr