ID: 1169335063

View in Genome Browser
Species Human (GRCh38)
Location 20:4749060-4749082
Sequence CTGACTGAACAAAGAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169335058_1169335063 16 Left 1169335058 20:4749021-4749043 CCTGCTGGTGGGAAGAATGGGAG No data
Right 1169335063 20:4749060-4749082 CTGACTGAACAAAGAGAAGGAGG No data
1169335055_1169335063 24 Left 1169335055 20:4749013-4749035 CCTCTCTTCCTGCTGGTGGGAAG No data
Right 1169335063 20:4749060-4749082 CTGACTGAACAAAGAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169335063 Original CRISPR CTGACTGAACAAAGAGAAGG AGG Intergenic
No off target data available for this crispr