ID: 1169339268

View in Genome Browser
Species Human (GRCh38)
Location 20:4783787-4783809
Sequence CTGTGTTTAGAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 1, 2: 6, 3: 38, 4: 435}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169339268_1169339274 11 Left 1169339268 20:4783787-4783809 CCCTCTTCCCTCTCTAAACACAG 0: 1
1: 1
2: 6
3: 38
4: 435
Right 1169339274 20:4783821-4783843 GCTGCTCCCTGGCACTTGAGAGG 0: 1
1: 0
2: 1
3: 15
4: 168
1169339268_1169339273 0 Left 1169339268 20:4783787-4783809 CCCTCTTCCCTCTCTAAACACAG 0: 1
1: 1
2: 6
3: 38
4: 435
Right 1169339273 20:4783810-4783832 ACAGACGTGTGGCTGCTCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169339268 Original CRISPR CTGTGTTTAGAGAGGGAAGA GGG (reversed) Exonic
900510947 1:3060829-3060851 CTGTGTTTGGAAAAGGAAGCTGG - Intergenic
900560784 1:3305023-3305045 CTGTGTTGAGAAACGGATGATGG + Intronic
900740925 1:4330279-4330301 CTGGGTCTAGGGAGGGAAAAAGG + Intergenic
901540353 1:9911103-9911125 CTGTATTTGGAGAGGGTACAGGG + Intergenic
902727545 1:18347165-18347187 CTGTGTTCAGAGAGGGAGGGAGG - Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903801999 1:25975933-25975955 CTGTGATCAGAGAGAGAAGCAGG - Intronic
903916980 1:26771826-26771848 GTGAGCCTAGAGAGGGAAGAAGG + Intronic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904096024 1:27978069-27978091 CTGTCTTTGAAGATGGAAGATGG + Intronic
904124754 1:28230318-28230340 CTGTTTTCATAGAGTGAAGAGGG - Intronic
904621073 1:31775672-31775694 TTGGGTGTTGAGAGGGAAGATGG - Intergenic
905142823 1:35861934-35861956 CTGTGGCTGGAGAAGGAAGAAGG + Intergenic
905208750 1:36358762-36358784 CAGTGTTTGGCGAGGAAAGATGG - Exonic
905715859 1:40149308-40149330 CTGAGTTTAGAGAGGGAGCAGGG + Intergenic
906037999 1:42764934-42764956 CAGTGCTTAGAGAGTAAAGAAGG - Intronic
906753462 1:48287188-48287210 CTGGGTTAAGAGAGTGAAGGGGG + Intergenic
908427494 1:64021686-64021708 GTGTGTATAGGGAGGAAAGAAGG + Intronic
909417223 1:75420101-75420123 CTGTGTTTTCATAGGGTAGAAGG - Intronic
910316271 1:85887181-85887203 CTGACTTTAAAGAGGGAACAAGG - Intronic
912162439 1:107001834-107001856 ATGTCTTTAGAGAGCAAAGAAGG - Intergenic
912249550 1:107996824-107996846 ATGTGTATAGAGAAGCAAGAAGG + Intergenic
912424182 1:109571955-109571977 ATGAGTTTAGATAGGGAAAAGGG + Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912600122 1:110922328-110922350 CTGATATGAGAGAGGGAAGAAGG - Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912938957 1:114028227-114028249 TTGTGATTAGGAAGGGAAGAAGG - Intergenic
914898267 1:151696301-151696323 TTTTGTTTAGAAAGGGGAGAAGG - Exonic
915027475 1:152844228-152844250 CTGTGTTTACAGATGTAAGTGGG + Intergenic
915030959 1:152880203-152880225 CTAGGTTTTGAGAGGGACGAGGG - Intronic
915244668 1:154547859-154547881 CTCTCTTTTGAGAGGGAAGCTGG - Exonic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
916667694 1:166981483-166981505 ATGTGTGTAGAGAGGGAGGGAGG + Intronic
917865570 1:179191012-179191034 CTGTGGTTAGAAGGGGAAGTGGG - Intronic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918264479 1:182828533-182828555 CTGTGTTTGAAGCAGGAAGAGGG + Intronic
918720749 1:187849869-187849891 CTGTGTTGAGTGAAGGATGATGG - Intergenic
919652205 1:200161472-200161494 ATGTGTATACAGAGGGAAAATGG + Intronic
920084044 1:203401492-203401514 CTGTGTATAGAGAGTGCGGAAGG + Intergenic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
921749230 1:218773803-218773825 CTGGCTTTAAAGATGGAAGAAGG - Intergenic
922167869 1:223130687-223130709 CTCTGTTCAGATAAGGAAGAAGG - Intronic
922184269 1:223260111-223260133 CTGCATTTAGAAAGGGTAGAAGG - Intronic
922850343 1:228727949-228727971 GTGTGTTTGGGGAGGGAAGTTGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924487044 1:244495039-244495061 CTGTGTTTTGAGTGAGAAGGAGG - Intronic
1062823371 10:551103-551125 CAGTGTCTAGTGAGGGCAGAGGG - Intronic
1063450781 10:6148555-6148577 CGGTGGTTAGAGTGGGAGGAAGG + Intronic
1065168009 10:23001048-23001070 CTGTGTATAGATAGCAAAGATGG + Intronic
1065489781 10:26271203-26271225 CTGTATTTAGAGAGGAAAATAGG + Intronic
1066633294 10:37477801-37477823 CTTTGTTTGGGGAGGGTAGACGG - Intergenic
1067517408 10:46963580-46963602 ATGTGTGTACAGAGGGATGAGGG + Intronic
1067529140 10:47057842-47057864 TTGTGTCAAGTGAGGGAAGAGGG - Intergenic
1068124499 10:52822347-52822369 CTGAGTTCAGAGAAGGAAGATGG + Intergenic
1068149617 10:53115407-53115429 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069545116 10:69322114-69322136 GTTTGTTTAGAAAGGGAAGATGG + Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1069945223 10:71981084-71981106 CTGTTTTTTCAAAGGGAAGAAGG + Intronic
1070261216 10:74857716-74857738 GTCTGTTTAGAAAGGAAAGAGGG + Intronic
1070550786 10:77489024-77489046 CTCTGCCTAGAGGGGGAAGATGG - Intronic
1071228614 10:83560745-83560767 CTGTGTTTTGAGTGTAAAGATGG - Intergenic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1073347514 10:102794991-102795013 CTGTATTTAGAGGAGGGAGAAGG + Intronic
1074406499 10:113184169-113184191 CCGCGTTGAGAGAGGGAAAATGG - Intergenic
1075900197 10:126036865-126036887 CTGTTTTTAGAAAGAGAGGAAGG - Intronic
1076141289 10:128080398-128080420 CTGTGCATAGAGAGGCAGGAAGG + Intronic
1077906870 11:6541098-6541120 CTGTGTGGAGAGAGGGAGGTGGG + Intronic
1079564129 11:21860135-21860157 CTGTGCTAAGAGAGAGAATATGG - Intergenic
1079793743 11:24772303-24772325 GTGTGTTTATTGAGGCAAGAAGG - Intronic
1081307269 11:41528773-41528795 CTTTGTTTTGAGGGGGAAAAAGG - Intergenic
1081367435 11:42253128-42253150 CACTGTTTAAAGAAGGAAGAAGG + Intergenic
1081845136 11:46235477-46235499 CTGGGTTCAGAGATAGAAGATGG + Intergenic
1082256916 11:50041990-50042012 CTGTGTGTAAAGAAGGAAAATGG + Intergenic
1083179400 11:60974546-60974568 CTAGGGTTAGAAAGGGAAGAAGG - Intronic
1083222755 11:61264364-61264386 CCATGTTCAGAGAGGGAACACGG - Intronic
1083904367 11:65660454-65660476 CTGTGTTTAGAGAGTGGAAAAGG - Intronic
1084253659 11:67922954-67922976 CTGTGTTTAAGGTGAGAAGAGGG - Intergenic
1084415230 11:69028345-69028367 CTGAGTTTGGAGAGGAAAGCAGG - Intergenic
1085168144 11:74423381-74423403 CTGGCTTTAGAGAGAGAAGAAGG + Intergenic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1085751612 11:79167233-79167255 CTGAGTTCACAGTGGGAAGAAGG + Intronic
1085832505 11:79916473-79916495 CTGGGTTTGGAGAGGGCAGTTGG + Intergenic
1085875496 11:80402382-80402404 ATGAGCTCAGAGAGGGAAGAGGG - Intergenic
1086258032 11:84903247-84903269 CTGTGTTCAGAGAGTAAAGAAGG - Intronic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087537925 11:99475271-99475293 CTGTGTTATGACAGGGCAGATGG - Intronic
1087652119 11:100879942-100879964 CTGTGTGTTGAAAGGGATGAGGG - Intronic
1087978141 11:104575909-104575931 CTGTGTTCTCAGAGGGGAGAAGG - Intergenic
1088569438 11:111207332-111207354 CAGTGAGTAGAGAGAGAAGATGG - Intergenic
1089418918 11:118316325-118316347 CTCTCTTTAGAGAGGGCATAAGG + Intergenic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1091001575 11:131914110-131914132 CTGTGTACAGAGAGGCAAGTAGG + Intronic
1091248942 11:134125219-134125241 CTAAGTTGAGAGAGAGAAGAGGG - Intronic
1091853139 12:3717099-3717121 CTGGGCTTAGAGAGTGAATAGGG + Intronic
1091935994 12:4434921-4434943 CTGTGTGTGGTGGGGGAAGAAGG + Intronic
1092741464 12:11634069-11634091 CTGTGGTTAGTGTGGGCAGAAGG - Intergenic
1093669520 12:21856967-21856989 CAGTGCTGAGAGAGGGTAGATGG - Intronic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1096060706 12:48697130-48697152 CTTTTTTTAAAAAGGGAAGAAGG + Intronic
1096862570 12:54540391-54540413 ATGTGTTTGGTGAGGCAAGAGGG + Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1098899655 12:76099812-76099834 CTTTGTTTAAAGGGGGAAGCTGG + Intergenic
1099016437 12:77348942-77348964 CTGGTTTTAAAGATGGAAGAAGG - Intergenic
1100024464 12:90110959-90110981 CTTTGTTTAGAGGAGGAGGAAGG + Intergenic
1101643115 12:106602697-106602719 CTGAGTTTAGTGAGGGAGCAAGG - Intronic
1101840722 12:108325742-108325764 GTGTGTTTAGAGAGGCAGGATGG - Intronic
1102518430 12:113465103-113465125 CAGGGTTTGGAGAGGGAAGAGGG - Intronic
1102788822 12:115626498-115626520 CTGTGTTTAGGGATGGAATTTGG - Intergenic
1104212625 12:126704425-126704447 CTTTGTTTACATAGGGAAGAGGG - Intergenic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1106186545 13:27414828-27414850 CTGTCTTGAAAGAGGGGAGAAGG + Intergenic
1106674129 13:31939768-31939790 GTGTCTTTAGAGAGGGAAATGGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107136355 13:36948102-36948124 CTGTGCTTAGAAAGGTAAGCTGG + Intergenic
1107444324 13:40456982-40457004 ATGTCTTTATAGAAGGAAGAGGG + Intergenic
1107860893 13:44660146-44660168 CTGTGTGTAGACATGGGAGAGGG + Intergenic
1108345742 13:49545424-49545446 CTGTGTTTAGACAGTGAGTAAGG - Intronic
1109237411 13:59842121-59842143 CTGGGTTTAGGCAGGGAATATGG - Intronic
1109266057 13:60201615-60201637 CTGGCTTTAGAGATGGAGGAAGG - Intergenic
1111819596 13:93196280-93196302 CTGTGTTTTGAGATGGATGAAGG - Intergenic
1113124275 13:106958997-106959019 TTGTGTTTGGGAAGGGAAGAAGG + Intergenic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1113223299 13:108129928-108129950 CTGTGTTTGGAGGGGAAAGTGGG + Intergenic
1115766160 14:36625540-36625562 CTCTGTTTGGAGAAGGAAGCCGG - Intergenic
1116054884 14:39851233-39851255 CTGTGTTTTGAAAAGGAAAATGG - Intergenic
1116583260 14:46669731-46669753 CTCTGTTGAGAGAGAGAGGAGGG - Intergenic
1116899527 14:50348518-50348540 CAGAGTCTAGTGAGGGAAGAGGG - Intronic
1118659380 14:67990917-67990939 TTCTTTTTAGAGAGGGTAGAAGG + Intronic
1121827825 14:97025296-97025318 CAGGGTTTGAAGAGGGAAGATGG - Intergenic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1122474578 14:101998161-101998183 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1122474597 14:101998255-101998277 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1122474615 14:101998349-101998371 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1125055144 15:35350778-35350800 CTGTGGTTAGAGAAGATAGATGG + Intronic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1128498207 15:68210244-68210266 CGGTGTGTGGAGAGGGGAGAGGG - Intronic
1128612441 15:69084764-69084786 ATGTGATTAGAGAGGGAAAGAGG - Intergenic
1128908191 15:71487252-71487274 CTCTGTTTGGAGATGGAAGGTGG + Intronic
1129261452 15:74370316-74370338 CTGTCTTGAGAGAGCCAAGAAGG - Intergenic
1130346274 15:83048608-83048630 CTGTGTTTGGATAGTGGAGAGGG - Intronic
1130763492 15:86845953-86845975 CTTTCTTTCAAGAGGGAAGAAGG - Intronic
1132040225 15:98518893-98518915 CTTTTTTTAGAAAGGGAAAAAGG + Intergenic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1133361888 16:5180556-5180578 CTTTGAATAGAGTGGGAAGAAGG - Intergenic
1133550371 16:6848615-6848637 ATGTGTGTAGAGAGAGATGATGG + Intronic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1133815411 16:9193798-9193820 CTGGCTTTGGAGAGGGAGGAAGG - Intergenic
1134017491 16:10899224-10899246 GTGGGTTTGGAGAGGGAGGAAGG - Intronic
1134049911 16:11130291-11130313 CCGTGTTCAGAGAAGGGAGAAGG - Intronic
1134813784 16:17189176-17189198 TGGTGTTGAGAGAAGGAAGAAGG + Intronic
1135664575 16:24325150-24325172 CTGTGTCTACTGGGGGAAGAGGG + Intronic
1136186541 16:28591819-28591841 CCCTGTTTGGAGAGGGGAGAGGG - Intergenic
1137006281 16:35276665-35276687 CTTTGTTTAGAAAGGGGAGGGGG + Intergenic
1137590069 16:49687966-49687988 CTGTTTTTTGGGAGGGCAGATGG - Intronic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1138907413 16:61353949-61353971 CTGTGTTAAGTGAGGCAGGAAGG - Intergenic
1139476050 16:67203096-67203118 CTGCGTGGAGAAAGGGAAGAGGG - Intronic
1139591841 16:67937323-67937345 CCCTCTTGAGAGAGGGAAGATGG - Intergenic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1140298179 16:73728995-73729017 GTGTGTTCAGCCAGGGAAGAAGG + Intergenic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1140720000 16:77763194-77763216 CTGGGGTAAGAGAGGGAAGGAGG - Intergenic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1141581120 16:84999758-84999780 CTGTATCTTGAGAGGGAAGTGGG + Intronic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1143741058 17:8954400-8954422 CTGTGTTTTCAGAGGGAGTAAGG - Intronic
1144180338 17:12745715-12745737 CTTTGTTTAGGGAGATAAGAGGG - Intronic
1144443020 17:15301065-15301087 CTGTTTAGAGAGAGGGATGAGGG + Intergenic
1144783939 17:17821603-17821625 CTCAGTTTACAGGGGGAAGAGGG + Intronic
1147222141 17:38941678-38941700 GTGTGTATTGAGAGGGGAGAGGG + Intronic
1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG + Intergenic
1148334934 17:46834726-46834748 CTGAGTTGTGAGAGGGCAGAGGG - Intronic
1148516857 17:48227163-48227185 CTGTGAATGGAGAGGGAACATGG + Intronic
1148867495 17:50636309-50636331 CTGTGTTTAGAATGGGCTGAAGG + Intronic
1149028381 17:52056274-52056296 TTCTGTTCAGTGAGGGAAGAAGG + Intronic
1150981115 17:70142602-70142624 CTGTGTTTCCACAGGGTAGAAGG - Intergenic
1150986828 17:70207312-70207334 CTGTGTTTAAAGAGTAAAAAAGG - Intergenic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152784096 17:82239114-82239136 CAGTGTTTTGAGGGGGAAGGTGG + Exonic
1152875192 17:82782397-82782419 CTGTAATTAAAGAGAGAAGAAGG - Intronic
1153339230 18:3957225-3957247 CTGAGTTTGGAGATGGAAGAAGG + Intronic
1154355847 18:13622720-13622742 CTGTGTTTTGAGAGAGGACAGGG + Intronic
1156104829 18:33647505-33647527 TTGTGATTAGAGAGGGGAAAAGG + Intronic
1156376534 18:36519708-36519730 CTGAGGTAAGAGAGGGAAGCTGG + Intronic
1156646312 18:39166148-39166170 CTATCTTCAGAGAGGGGAGAAGG + Intergenic
1156838706 18:41585988-41586010 CTGCGTTTGGAGAGGAAAGGAGG + Intergenic
1156872005 18:41955865-41955887 CAGTGTTTAGTCAGGGAAGTTGG + Intronic
1157011129 18:43650232-43650254 CTGTGTTTTGGGAGAGAGGAAGG + Intergenic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157386680 18:47263863-47263885 CTAGGCTGAGAGAGGGAAGAGGG - Intergenic
1157943563 18:51955077-51955099 CTGTGTAAAGGGAGGGAAAAGGG + Intergenic
1158010107 18:52718984-52719006 CTGAGTTTTCAGAGGGAAAATGG - Intronic
1158373031 18:56831254-56831276 ATGTGTATAGAGTGGGAACAGGG + Intronic
1159225077 18:65523189-65523211 CTGTGCTTGAAGAGAGAAGAGGG + Intergenic
1159521623 18:69532216-69532238 CTCTGTTCAGATAGGCAAGAGGG - Intronic
1159912040 18:74154708-74154730 CTGTGTTCAGAGTAGGAATATGG - Intronic
1160019971 18:75172811-75172833 TTGTGTTAAGAGGGAGAAGACGG + Intergenic
1160451455 18:78969235-78969257 CTGTCTATAGAGAGGGGATAAGG - Intergenic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161838095 19:6661353-6661375 CTTGGTTTAGAAGGGGAAGAGGG + Intronic
1163541801 19:17915900-17915922 CTTTCTCTGGAGAGGGAAGAGGG - Intergenic
1163872650 19:19835795-19835817 CTGTGTTTAGAGAGTAGTGAGGG - Intergenic
1164411681 19:28011387-28011409 TTGTGTGTAGAGAGGAATGAAGG + Intergenic
1164700650 19:30281664-30281686 CTGTGCTTTAAGAGGGAAGCAGG + Intronic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1165934921 19:39383476-39383498 CTGTGGTAAGAAAGGGAGGAAGG - Intronic
1168094441 19:54106715-54106737 TTATGTTCAGAGAGGGAAGGGGG - Intronic
925329055 2:3044076-3044098 CTGTGTTTGGAGAGGGATTTAGG + Intergenic
925516987 2:4693501-4693523 CTGCGTGGGGAGAGGGAAGACGG + Intergenic
927151355 2:20198302-20198324 CGGTGTTGGGAGAGGGAGGAAGG + Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
929211910 2:39366539-39366561 CTGAATTCAGAAAGGGAAGAGGG + Intronic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
931168293 2:59775157-59775179 AAGTGTTTGGAAAGGGAAGAAGG - Intergenic
931789000 2:65646803-65646825 ATTTGGTTAGAGAGGGAAGTTGG - Intergenic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932076192 2:68665357-68665379 CTGTGTTTAAAGGGGAAAAAAGG - Intergenic
932201904 2:69836052-69836074 CTGTGTTCATAGAGTGGAGAAGG + Intronic
934232053 2:90192943-90192965 CTATGTTAAGGGAGGCAAGAAGG - Intergenic
934965369 2:98716987-98717009 CTGTGTATACAGAGGGCCGACGG + Intronic
935077861 2:99763196-99763218 CTGTGTTTAAAGGGGGATGTTGG - Intronic
935271130 2:101435317-101435339 GTGTGTTTCGGGAGGGATGAGGG + Intronic
935347463 2:102121685-102121707 CTTTGTTGAGAGAGAGAAAATGG - Intronic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
936401759 2:112169936-112169958 CTGTTTTAAGAAAAGGAAGAAGG + Intronic
940963457 2:159811664-159811686 CTGTGATTAGAGAGGAATGGCGG + Intronic
941734237 2:168955662-168955684 CTGTGTTTTGAAATGTAAGAAGG - Intronic
942766946 2:179468650-179468672 CTGAATCTAGAGAGGAAAGAGGG - Intronic
943345883 2:186736181-186736203 CTCAGTTTAGAGTGTGAAGATGG - Intronic
946629218 2:221648069-221648091 CTGTCTTTAAACAGTGAAGACGG - Intergenic
947175557 2:227363484-227363506 CTGTGTGTAGAGAAAGGAGAAGG - Exonic
947205484 2:227657296-227657318 CAGCGTTTGGAGAAGGAAGAAGG + Intergenic
947387519 2:229606397-229606419 GTCTGTTTAGAGAGAGCAGAAGG + Intronic
947538069 2:230953421-230953443 CTGGGTTTGAAGACGGAAGAAGG + Intronic
947589735 2:231378785-231378807 CTGGGTTTACTGAGGGAAGGTGG + Intergenic
948132971 2:235614439-235614461 ATGTATTTGGGGAGGGAAGAAGG + Intronic
948952862 2:241265814-241265836 CCCTTTCTAGAGAGGGAAGACGG - Intronic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1170397691 20:15945910-15945932 GTGTGTCTAGAGAAGGCAGAGGG + Intronic
1170758394 20:19225604-19225626 CAGGGTTCAGAGATGGAAGAAGG - Intronic
1171295466 20:24012947-24012969 GTGTCTTTACAGAGAGAAGAGGG - Intergenic
1173033813 20:39389352-39389374 CTGTCTAGAGAGAGAGAAGAAGG - Intergenic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1173315744 20:41941576-41941598 CTCTGTTCAGAGAGAGATGAAGG - Intergenic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1174836927 20:53865061-53865083 CTGTGTACAGAGAGGGCCGATGG + Intergenic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1177551935 21:22634448-22634470 CTGTGTTTTCACAGGGAAAAGGG + Intergenic
1178152403 21:29810534-29810556 CTGAGTTTAAAGAAGGAAAATGG - Intronic
1178424760 21:32470564-32470586 GTGTTATCAGAGAGGGAAGATGG - Intronic
1179390237 21:40982343-40982365 CTGTGTTTTGAGAGTAAAGCAGG - Intergenic
1179823452 21:43950821-43950843 CTGCGTTTAAAGCGGGAGGAAGG + Intronic
1179977561 21:44877748-44877770 CTGTTTTTAGAGAGCGTATAAGG - Intergenic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1180910526 22:19447135-19447157 AGTGGTTTAGAGAGGGAAGAGGG - Intronic
1181928946 22:26383801-26383823 CTGAGCTAAGAGAGGGAGGATGG - Intergenic
1182213530 22:28696676-28696698 TTGTGCTTAGAGAGAGAGGAGGG - Intronic
1184147300 22:42619190-42619212 CTCTGGCTAGAGTGGGAAGAGGG - Exonic
1184422190 22:44388764-44388786 CTGGCTTTGGAGATGGAAGAAGG + Intergenic
1184677284 22:46050631-46050653 CTGGCTTTAAAGACGGAAGAAGG - Exonic
1185001632 22:48250029-48250051 ATGTGTTTAGAGGGGGATGTGGG - Intergenic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
950508010 3:13407670-13407692 CTGTGTTTGGTGAGCTAAGAAGG - Intronic
950838335 3:15942116-15942138 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
951051249 3:18096577-18096599 CTGTCTTTGAAGAGGGAGGAAGG - Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951460397 3:22945534-22945556 CTGGAATTAGGGAGGGAAGACGG + Intergenic
951467237 3:23014502-23014524 CTGTGCTCAGAGAGGTATGAAGG + Intergenic
951570786 3:24060672-24060694 ATGTGATTTGAGAGAGAAGATGG - Intergenic
951724609 3:25743312-25743334 TTGAGGTCAGAGAGGGAAGAGGG - Intronic
951746434 3:25982801-25982823 CTGTGTTCAGAAAAGGCAGATGG - Intergenic
954195947 3:48997322-48997344 CTATGTGTTGAGTGGGAAGATGG - Intronic
955059489 3:55483329-55483351 CTGGGATTGAAGAGGGAAGAGGG - Intronic
955566329 3:60250894-60250916 CTGTGTTTGGTGAGGGCAGTGGG - Intronic
955968609 3:64414079-64414101 CAGTGTTCAAAGAGGGGAGAAGG - Intronic
958018084 3:87966153-87966175 CTGAGGTTAGAGTGAGAAGACGG - Intergenic
959190517 3:103104582-103104604 CTGGGTTTAAAGATGGAAGGAGG + Intergenic
959264436 3:104119618-104119640 CTGTGTGTGGAGTGGGGAGAGGG - Intergenic
959357304 3:105348509-105348531 CTGTCTTTTGAGAGGAAGGAAGG - Intergenic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
960185882 3:114638251-114638273 CTATGTTCAAAGAGGGAAGGAGG - Intronic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
962083675 3:132167587-132167609 ATGTGTTCAGAGAGGGGAGGAGG + Intronic
963285614 3:143431787-143431809 CTGAGTTTAGAGAAGTAAGAGGG - Intronic
964886708 3:161491853-161491875 CTGTGTTTAAATCGGGAAGCAGG + Intergenic
964939784 3:162143802-162143824 CTTTATTTAAAGAGGGAGGAAGG - Intergenic
966940061 3:184740664-184740686 CTGTGTTTGGGGGAGGAAGAGGG - Intergenic
967367370 3:188702415-188702437 CAGTGTTCTGAGACGGAAGAAGG - Intronic
967724316 3:192847339-192847361 TTGTTTTTAGGGAGGGAATAAGG - Intronic
968684071 4:1944520-1944542 CTGTGCTTGGAGAGGGGAGGTGG + Intronic
970420494 4:15901509-15901531 CTGGCTTTAAAGATGGAAGATGG - Intergenic
970467889 4:16345969-16345991 CTGTCTTTGAAGATGGAAGAAGG - Intergenic
970520953 4:16883389-16883411 TTAAGTTTACAGAGGGAAGAAGG + Intronic
971155296 4:24075262-24075284 CTGTGTTTTCACAGGGAGGAAGG - Intergenic
971663820 4:29456341-29456363 CTGTCTTTAAAGATGGAGGAAGG - Intergenic
974093292 4:57335002-57335024 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
975177188 4:71301412-71301434 CGGAGTTAGGAGAGGGAAGAAGG + Intronic
975282896 4:72583243-72583265 CTGGCTTTGGACAGGGAAGAAGG + Intergenic
975387960 4:73780746-73780768 CTGTGTTGATAGAGGTAGGAAGG + Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976416083 4:84777048-84777070 CTGTTTATACACAGGGAAGAAGG + Intronic
976697184 4:87929608-87929630 TTATGTGTAGAGAAGGAAGAGGG + Intergenic
977041091 4:92020035-92020057 CTGTTCTTAAATAGGGAAGAAGG - Intergenic
978444113 4:108764234-108764256 CTGTGTTTTGAAAGGGCAGCAGG + Intergenic
979440000 4:120740449-120740471 GTGGGTTTAGAGAGGAAGGAGGG - Intronic
980383749 4:132060525-132060547 CTGCCTTTGAAGAGGGAAGAAGG + Intergenic
980415427 4:132482755-132482777 CTGTGGTTGGAGAGAGCAGATGG + Intergenic
980620455 4:135294707-135294729 TTGTACTGAGAGAGGGAAGATGG - Intergenic
981584435 4:146285938-146285960 CTGTGTTTTGAGTGGTGAGAAGG + Intronic
981584444 4:146286010-146286032 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584450 4:146286058-146286080 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584487 4:146286318-146286340 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584490 4:146286342-146286364 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584496 4:146286390-146286412 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584499 4:146286414-146286436 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584511 4:146286506-146286528 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584514 4:146286530-146286552 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584516 4:146286554-146286576 CTGTGTTTCGAGTGGTGAGAAGG + Intronic
981584546 4:146286746-146286768 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584557 4:146286838-146286860 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584573 4:146286982-146287004 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584576 4:146287006-146287028 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584579 4:146287030-146287052 CTGAGTTTAGAGTGGTGAGAGGG + Intronic
981584584 4:146287078-146287100 CTGTGTTTCGAGTGGTGAGAAGG + Intronic
982231328 4:153210917-153210939 ATGTGTTGAGTGTGGGAAGAGGG - Intronic
982951497 4:161702811-161702833 TTGTTTTTTGAGTGGGAAGAGGG - Intronic
983506493 4:168558545-168558567 CAGAGTTCGGAGAGGGAAGAAGG - Intronic
983620052 4:169751525-169751547 CCGTGAATAGAGAAGGAAGATGG - Intronic
985189788 4:187360316-187360338 TTGTATTTGGGGAGGGAAGAAGG + Intergenic
986118841 5:4810613-4810635 ATTTGTTTAGATAGGGAAGAAGG + Intergenic
986333940 5:6738855-6738877 CTGTGGTTACAGAGGGAAATTGG + Intronic
987960492 5:24802441-24802463 CTGACTTTAAAGATGGAAGAAGG - Intergenic
988636882 5:32994539-32994561 GTGTGTGTAGAGAGGGAGGTAGG - Intergenic
990334779 5:54761846-54761868 CTGTGTCTTCAGGGGGAAGAAGG + Intergenic
990902400 5:60766859-60766881 CTGGGGTTAGAGAGGGAGAATGG - Intronic
992496326 5:77297713-77297735 ATGTGGCTAGAGAGGGAGGAAGG - Intronic
993907222 5:93636490-93636512 CTGTGTCTTCACAGGGAAGAAGG - Intronic
994076707 5:95659941-95659963 CAGTGTTCAAAGAAGGAAGAGGG - Intronic
994236163 5:97365551-97365573 CTGTGTTCAGAGTGGGAACAGGG + Intergenic
994568180 5:101481423-101481445 CTATGTTTATAGAGAGAAAATGG + Intergenic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
994780839 5:104088062-104088084 CTGAATTTAAAGATGGAAGAAGG - Intergenic
994949204 5:106435313-106435335 CTGTCTTTACAGAAAGAAGAAGG - Intergenic
995550940 5:113280682-113280704 CTTTGTTTTGAGAGGGCAGGAGG + Intronic
996021534 5:118595948-118595970 CTGTGTGAAGACAGGGAACATGG - Intergenic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
997602326 5:135149237-135149259 CTCTATTAAGAGAGAGAAGAAGG + Intronic
998186154 5:139981496-139981518 CTGTGTTAAGAGAAGGGAAACGG - Intronic
998434443 5:142095610-142095632 CTGTGTTTTGGAAGGGAGGAGGG + Intergenic
998519169 5:142784146-142784168 CTCTGTTTAGAGCAGCAAGATGG + Intronic
999401407 5:151267178-151267200 CTGTTTTGAGAATGGGAAGAGGG + Intronic
999768678 5:154758032-154758054 TTGAGTTTAAAGAGGGGAGAAGG - Intronic
1000337335 5:160251595-160251617 CTGATTTGAGAGAGGGAAGGAGG + Intergenic
1001753587 5:174149680-174149702 CTCTGTTCAGAGAGGGACAAGGG + Intronic
1001922831 5:175613941-175613963 CTGTGTTCAGAGAGTGGAGGAGG + Intergenic
1002028510 5:176411864-176411886 CATTCTTTAGAGAGGGAAGCAGG - Intronic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1003387518 6:5683012-5683034 ACGTGTTCAGAGAGGGAAGCAGG + Intronic
1004423603 6:15492741-15492763 CTGGGTTTCGAGGAGGAAGATGG + Intronic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1004996715 6:21200461-21200483 CTGTGTTTTGAGGGAGAAGGAGG - Intronic
1005440123 6:25858338-25858360 CAGTGTTTTGAGAGTGAAAATGG - Intronic
1006583120 6:35088005-35088027 CTCTGTTCTGTGAGGGAAGAAGG - Intronic
1006846914 6:37068792-37068814 CGATTTTTATAGAGGGAAGATGG - Intergenic
1006905643 6:37531655-37531677 TTGTCTTCAGAGAGGGAAGCTGG + Intergenic
1007098160 6:39227277-39227299 CTTTGTTTAGAGGGGGAAGAGGG - Intronic
1007178694 6:39913280-39913302 ATGGGTTGAGGGAGGGAAGAAGG - Intronic
1007562484 6:42821506-42821528 CTGCATTTAGAGAGAGAAGAGGG - Intronic
1007819484 6:44550518-44550540 TTGTTTTGGGAGAGGGAAGACGG - Intergenic
1007881275 6:45170045-45170067 CTGTGTTGAAAGAGAGAAGTGGG - Intronic
1008217151 6:48806639-48806661 CTGTCTTTAGAGACTGGAGAGGG + Intergenic
1008696400 6:54043499-54043521 CTTTCTTTAGAGAGGGTTGAGGG - Intronic
1010356019 6:74934601-74934623 CTGTTTTGAGATAGGGGAGAGGG + Intergenic
1011339274 6:86294755-86294777 CTGTGTGTAGAGAAGTCAGAAGG - Intergenic
1012971455 6:105736038-105736060 CTCTGTTTAGAGAGGGTTGTGGG - Intergenic
1013420521 6:109962589-109962611 CTGTGTTCAGAGAGGAAAGAGGG + Intergenic
1013565394 6:111354629-111354651 ATGTTTTTAGAGAGGAAAAATGG - Intronic
1014545852 6:122734467-122734489 GTGTGGTGACAGAGGGAAGATGG + Intergenic
1014808608 6:125859962-125859984 TTGTTTTTTGAGAGGGAAGTAGG + Intronic
1014827838 6:126066469-126066491 ATGTATGTCGAGAGGGAAGATGG + Intergenic
1017605242 6:156126546-156126568 CTGTAATTAGAAAGGGAAGCAGG - Intergenic
1018549716 6:164981782-164981804 CTGTGTTTGTACAGGGTAGAAGG - Intergenic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018995798 6:168709676-168709698 CTGGGTTTAGAGATGGAAAACGG - Intergenic
1020743789 7:12055523-12055545 CTGTCTTTAGAGAGTGGGGATGG - Intergenic
1020760912 7:12267825-12267847 CTCTATTTAAAGGGGGAAGAGGG - Intergenic
1020999493 7:15310970-15310992 GTGTTTTTAGAAATGGAAGAGGG - Intronic
1021301734 7:18981597-18981619 CTGGCTTTAAAGATGGAAGAAGG - Intronic
1021631764 7:22654592-22654614 CAGTCTTCAGAGAGAGAAGAAGG - Intergenic
1022308044 7:29168658-29168680 CTGAGGTTTGAGGGGGAAGAGGG - Intronic
1022495354 7:30849882-30849904 CTGTGTTTTGAGTGGGCACATGG - Intronic
1023882652 7:44329292-44329314 GTGTGTTTAGGGAATGAAGACGG + Intronic
1024550535 7:50559269-50559291 CTGTGTTGAGAGACAGCAGAGGG - Intronic
1025300256 7:57814331-57814353 ATGTGTTCAGGGAGGGAAGCAGG - Intergenic
1026422842 7:70258290-70258312 CTGTGTTCATAGGGGAAAGATGG + Intronic
1026562837 7:71464551-71464573 TTGTGCTGAGGGAGGGAAGATGG - Intronic
1026980538 7:74524057-74524079 CTGTGTTTTGATAGAGAAGTGGG + Exonic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1028245927 7:88477195-88477217 CTGAGATGAGAGTGGGAAGAAGG + Intergenic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028496337 7:91464847-91464869 CTGTGTCTAGAGAAAGAAAATGG - Intergenic
1028873649 7:95796175-95796197 GTGTGTTTAGTGAGGGGAGAAGG + Intronic
1031270364 7:119641723-119641745 CTGAATTTAAAGAGAGAAGAAGG - Intergenic
1031532343 7:122889914-122889936 ATGTGTTCAGAGTGAGAAGAGGG + Intergenic
1031647356 7:124242489-124242511 CTTTGTTGAGAGAAAGAAGAAGG + Intergenic
1032306816 7:130741796-130741818 CTGCCTTTACAGAGGGAGGAAGG - Intergenic
1032959557 7:137015684-137015706 CTGTGTTCAGGGAGAGGAGAAGG + Exonic
1032977456 7:137241938-137241960 CTGTGTTGAGAGAGGTGAGGGGG - Intronic
1034453032 7:151148028-151148050 CTTTGTAAAGAGAGGCAAGATGG + Intergenic
1035399223 7:158553919-158553941 GTGTGTTTAGACAGGGAGGGTGG - Intronic
1037086857 8:14862798-14862820 CTGTGTCTAGAGGGGAAAGCAGG - Intronic
1037106044 8:15110193-15110215 CTGTCTTTAGGGAGGGAGGTAGG + Intronic
1037793480 8:21969460-21969482 CTGTGAAAAGAGAGGGAAAAAGG - Intronic
1038525674 8:28271077-28271099 TTGTCTCTAGAGAGGGAGGAAGG - Intergenic
1039713495 8:40083479-40083501 CTGTGTTTACAGTGGAGAGAGGG - Intergenic
1039740406 8:40377760-40377782 CTGAGTTTAGGGAAGGGAGATGG + Intergenic
1039858518 8:41436815-41436837 CTGGGTATAAAGAGAGAAGAAGG + Intergenic
1040547043 8:48406855-48406877 CTGAGGTCAGCGAGGGAAGATGG + Intergenic
1040554335 8:48466032-48466054 CTAGGTTTAGAAAGGGAAGACGG + Intergenic
1041329562 8:56710322-56710344 CTGTGCTTTGTGAGTGAAGATGG + Intergenic
1043601185 8:81940391-81940413 CTGTGGTTAGAGAAAGAATAAGG + Intergenic
1043809956 8:84727053-84727075 GTGTGTTTAGAGAATGAAGAGGG + Intronic
1045074844 8:98553066-98553088 CTGCCTTTAGAAAGTGAAGAAGG + Intronic
1046508047 8:115161486-115161508 CTGAGTTTAGAGATTAAAGATGG - Intergenic
1046750429 8:117920948-117920970 GTATGTTTAGGGAGGGACGAGGG - Intronic
1047037920 8:120959993-120960015 CTATGTTTAGAAAGGGTAGAAGG + Intergenic
1047715862 8:127594586-127594608 CTGTGTTCAGAGAAGGTTGAAGG + Intergenic
1047902274 8:129436321-129436343 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
1047979393 8:130164606-130164628 CTGTTTTTAGAGTTGGAAGTAGG - Intronic
1048235803 8:132689091-132689113 ATGTGATTAGAGAGGAAAGATGG + Intronic
1048536902 8:135305014-135305036 ATGTGTTTAGTGATGGAAAACGG - Intergenic
1048673578 8:136751268-136751290 AAGCGTTTAGATAGGGAAGAAGG - Intergenic
1048919268 8:139213225-139213247 CTGTGTTATGAGATGAAAGAAGG - Intergenic
1050615880 9:7401308-7401330 CTGTATTTAAAGAGGAGAGAGGG - Intergenic
1050858827 9:10397447-10397469 TTGTTTTTGGAGAGGGAACAAGG + Intronic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051718231 9:20008195-20008217 CAGGCTTAAGAGAGGGAAGAGGG - Intergenic
1051959419 9:22739983-22740005 CTTTGTTTAGCTAGGGAAAATGG - Intergenic
1052367141 9:27625057-27625079 CTGGGTTTAGAGACGAAGGAGGG + Intergenic
1052488611 9:29133932-29133954 GTGTCTTTAGTGAGGGAAGGAGG - Intergenic
1055541126 9:77306444-77306466 GTGTGTAAAGAGAGGGAAAAGGG + Intronic
1056055952 9:82824294-82824316 CTGGGATTATAGGGGGAAGAAGG + Intergenic
1057134295 9:92676210-92676232 CTGTGTTTAGAAATGCAAGATGG + Intergenic
1058283834 9:103151188-103151210 CTGTGTTGTGAGAGGGATGCAGG + Intergenic
1058780651 9:108331187-108331209 CAGTGTTTAGAGAGAGATCACGG - Intergenic
1059007031 9:110414076-110414098 CTCTGTTTTGAAAGTGAAGAAGG + Intronic
1059081671 9:111256653-111256675 CTATGTTGAGAGAGAGAGGATGG - Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059801118 9:117750485-117750507 CTGTACTTGGAGAGGAAAGATGG - Intergenic
1061615943 9:131779007-131779029 CTGGCTTCAGAGATGGAAGAAGG + Intergenic
1061630036 9:131866528-131866550 CCGTGTTGAGACAGGCAAGATGG - Intronic
1185934849 X:4244788-4244810 CTGTGTTTGAAGACGGAAAAGGG + Intergenic
1186066292 X:5769019-5769041 ATGTGTTTAGAGAGAACAGAAGG - Intergenic
1188594717 X:31885273-31885295 GTATGTTTTGGGAGGGAAGAGGG - Intronic
1189296409 X:39921388-39921410 TTGTGTATAGAGGAGGAAGAGGG - Intergenic
1189740264 X:44110678-44110700 CTGTGTTTGAAGAGTGTAGAAGG - Intergenic
1190391430 X:49935596-49935618 CTGAATTTATAGAGAGAAGAAGG + Intronic
1190834442 X:54087359-54087381 CTGTGTTTGGAAACAGAAGAGGG - Intronic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1195850103 X:109273632-109273654 CTGTGATGAGAGATGGATGAGGG + Intergenic
1196527344 X:116741524-116741546 CTGGGTATAGAGAGGGACAACGG - Intergenic
1197080801 X:122413004-122413026 TAGTGTTTAGAGGGGGAAGGAGG + Intergenic
1197681115 X:129386463-129386485 ATGTCTTTAGGCAGGGAAGAGGG - Intergenic
1198074308 X:133180128-133180150 CTGTGTTAAGTGGGGAAAGAAGG - Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198237826 X:134752250-134752272 TTTTTTTTAGAGAGGGAAGTGGG + Intronic
1198380321 X:136077628-136077650 CAGTTCTTAGAGAGGGAAGTGGG - Intergenic
1199565460 X:149211156-149211178 CTGTGTTTAGTTAGGGAAGGGGG - Intergenic
1199684618 X:150255141-150255163 CTGTCTCTGGAGAGGGAAAAGGG - Intergenic
1201222892 Y:11789129-11789151 CTGTGTTTAGAAAGGCCAGTGGG + Intergenic
1201699776 Y:16867843-16867865 CTCTGCTTCGAAAGGGAAGAAGG + Intergenic