ID: 1169339476

View in Genome Browser
Species Human (GRCh38)
Location 20:4785437-4785459
Sequence CTGGAGAATAAAGCCGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169339476_1169339479 18 Left 1169339476 20:4785437-4785459 CCAGCAGCGGCTTTATTCTCCAG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1169339479 20:4785478-4785500 AATTCCACCATATCTATGAAAGG 0: 1
1: 0
2: 0
3: 14
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169339476 Original CRISPR CTGGAGAATAAAGCCGCTGC TGG (reversed) Intronic
900732210 1:4269503-4269525 CTGGATAATAAAGCCGCCAGTGG - Intergenic
901071774 1:6523648-6523670 CTGGAGAATGGTGCTGCTGCAGG + Exonic
903484589 1:23680243-23680265 TTGGAGAAAAAAGCAGCTACTGG + Intergenic
906258459 1:44368185-44368207 GTGGAGAAGAAGGCCACTGCAGG + Intergenic
910688947 1:89946628-89946650 CTGCAGAATATAGTGGCTGCTGG + Intergenic
915083474 1:153368013-153368035 CTGGAGAATAGGGCCTCTGGGGG + Intergenic
921889080 1:220335718-220335740 CTGGAAGATGAAGCCGCTGCTGG + Intergenic
922336121 1:224619297-224619319 CTGGAGGATAGAGCCAGTGCTGG - Intronic
923144506 1:231188450-231188472 CTGGAGAATAAAGATGCAGCTGG + Intronic
1063944600 10:11164786-11164808 CTGGAGAAAAAGGCCGGAGCTGG - Intronic
1066954304 10:42150144-42150166 CGGGGGAAAAAAGCCGCGGCAGG + Intergenic
1067448093 10:46365179-46365201 CTGTAAAATTAAGCTGCTGCAGG + Intergenic
1067589287 10:47495582-47495604 CTGTAAAATTAAGCTGCTGCAGG - Intergenic
1067636412 10:48003664-48003686 CTGTAAAATTAAGCTGCTGCAGG - Intergenic
1067717865 10:48703768-48703790 CTGGAGCATGAAGCAACTGCTGG - Intronic
1071208068 10:83306830-83306852 CTGGAAAAAAAAGCCACTTCAGG - Intergenic
1071608701 10:87016396-87016418 CTGTAAAATTAAGCTGCTGCAGG + Intergenic
1072422884 10:95304248-95304270 CAGGTGAAGAAAGCCTCTGCAGG + Intergenic
1073025716 10:100485999-100486021 GGGGAGAAAAAAGCCGCTGCTGG - Intergenic
1074450813 10:113558437-113558459 AAGGAGGATAAAGCCGCTTCAGG - Intronic
1080216249 11:29844641-29844663 CTGGGGAAGAAAGCTCCTGCTGG + Intergenic
1084771183 11:71343792-71343814 CTGGAGGCCAAAGCCCCTGCTGG + Intergenic
1090306592 11:125696559-125696581 CTGGACCAGAAAGCAGCTGCTGG - Intergenic
1091779196 12:3203189-3203211 CTGGAGAAGAAAGGCACCGCAGG - Intronic
1092561225 12:9615739-9615761 ATGGGGGATAAAGCAGCTGCTGG - Intergenic
1096134806 12:49190599-49190621 CTTGAGAATACAGCTGCTGCAGG + Intronic
1097722452 12:63037877-63037899 CTGGAGCCAAAAGCCACTGCTGG - Intergenic
1100991441 12:100255535-100255557 CTTCTGAATAAAGCAGCTGCTGG - Intronic
1106756419 13:32826968-32826990 CTGGAGAAGAAAGGGGCTGTGGG - Intergenic
1109503106 13:63264084-63264106 CTGGAGCAGGAAGCCGCTGCTGG - Intergenic
1113617586 13:111691965-111691987 ATGGAGACTCAAGCCGCTGAGGG + Intergenic
1113623116 13:111777225-111777247 ATGGAGACTCAAGCCGCTGAGGG + Intergenic
1117310694 14:54519645-54519667 CTGGAGAAGACAGCCTATGCTGG + Intronic
1126839094 15:52698368-52698390 CTGGATCATAAAGCAGATGCAGG - Intronic
1129007910 15:72389848-72389870 CAGGAGAATGAAGCAGATGCAGG - Intergenic
1131144137 15:90000815-90000837 CTGGAGAGGAGAGCCGGTGCGGG - Intergenic
1131753858 15:95539383-95539405 CTGGAGAATAAAACGACTGGGGG - Intergenic
1133097800 16:3458806-3458828 CTGGAGAAGAAAGTCGGAGCTGG - Intronic
1135572277 16:23558024-23558046 CTGGAGGCTGAAGCCGCGGCGGG + Exonic
1135852872 16:25980499-25980521 ATGGAGAATACAGCCGTAGCTGG - Intronic
1136737813 16:32478529-32478551 CGGGAGCAAAAAGCCGCGGCGGG + Intergenic
1203015260 16_KI270728v1_random:351048-351070 CGGGAGCAAAAAGCCGCGGCGGG - Intergenic
1203033595 16_KI270728v1_random:624206-624228 CGGGAGCAAAAAGCCGCGGCGGG - Intergenic
1144873652 17:18385202-18385224 CTGGAGAATAAAACCTTTGAGGG + Intronic
1145158813 17:20560579-20560601 CTGGAGAATAAAACCTTTGAGGG - Intergenic
1149277955 17:55065863-55065885 TTGGAGAGTAAGGCAGCTGCAGG + Intronic
1151471102 17:74318299-74318321 GTGGAGAATAAACCAGATGCAGG + Intergenic
1152678289 17:81652911-81652933 CTTGAAAATACAGCCACTGCCGG - Intronic
1157323140 18:46649332-46649354 CTGGAGAATCCAGCCCTTGCTGG + Intronic
1161883297 19:6972848-6972870 ATGGAGAATAAACCCACCGCAGG - Intergenic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
934739965 2:96713115-96713137 CTGGAGAATATCGCCTCTTCTGG + Exonic
935746531 2:106194175-106194197 CAGGAGGATGAAGCTGCTGCTGG - Exonic
941621625 2:167785386-167785408 AAGGAGAATAAAGCTGCTCCTGG - Intergenic
943185115 2:184598106-184598128 CTTGAGAAAGAAGCCGCTGCTGG + Intergenic
945801473 2:214436922-214436944 CTGCACAATAAACCCACTGCAGG - Intronic
946714123 2:222535429-222535451 GTGGAGGATGAATCCGCTGCTGG + Intronic
948052447 2:234988734-234988756 CAGGTGAACAAAGCCGTTGCGGG + Intronic
1169339476 20:4785437-4785459 CTGGAGAATAAAGCCGCTGCTGG - Intronic
1171132102 20:22663495-22663517 CAGGGGAATAAAGCTGCTGTTGG - Intergenic
1174321222 20:49743140-49743162 CTGGAGATCGAAGCCTCTGCTGG + Intergenic
1177650751 21:23958491-23958513 ATGGTGCATAAAGCTGCTGCAGG - Intergenic
1178917230 21:36712776-36712798 ATGGAGAAGAAAACCCCTGCAGG - Intronic
1179289727 21:40008002-40008024 CTTGAGAATAAAACCCTTGCAGG + Intergenic
1180014081 21:45071737-45071759 CTGGAAAATAAACCTGATGCTGG - Intergenic
1180167568 21:46037964-46037986 CTGGAGAATAAAGTGGGTGAAGG - Intergenic
1185291604 22:50030343-50030365 CTGGAGGATGCAGCGGCTGCTGG + Intronic
949097189 3:99576-99598 CTGTAGAATACAGCCGAAGCAGG - Intergenic
949673012 3:6422012-6422034 CTGGAGGATAAAGCCCTTGAAGG - Intergenic
950163094 3:10774580-10774602 CTGGTGGGTAAAGCCCCTGCTGG - Intergenic
950669070 3:14514375-14514397 CTGGAGGCCAAAGCCGCTGAGGG + Exonic
954398099 3:50303564-50303586 CTGGAGGAAGGAGCCGCTGCTGG + Exonic
955089696 3:55737322-55737344 CTGGATATTAATGCTGCTGCCGG - Intronic
960761259 3:121075859-121075881 CTGGAGAACAATGCACCTGCAGG - Intronic
964544567 3:157819689-157819711 CTGGAGAAGAAACCAGCAGCAGG - Intergenic
966876533 3:184325330-184325352 CTGCAGCATAAAGCGGATGCGGG - Exonic
968078211 3:195828745-195828767 CTTGAGAAGACGGCCGCTGCTGG + Intergenic
971719050 4:30221050-30221072 CTAGAGAATAATGACACTGCAGG - Intergenic
972153377 4:36124596-36124618 CTGGAGAATAAAGGATGTGCAGG - Intronic
979144112 4:117218992-117219014 CAGTAGAATAAAGCCCTTGCTGG - Intergenic
985599168 5:816855-816877 CAGGAGAACAAAGCAGCAGCGGG + Intronic
987237572 5:15958301-15958323 ATGGAGAATAAAGCCCCTGGTGG - Intergenic
987248596 5:16076200-16076222 CTGGAGAACAAACCCACTACTGG + Intronic
989469115 5:41794704-41794726 CTGGAGAAAAAAGAGGCTCCTGG + Exonic
992281838 5:75186004-75186026 CTGCAGAATAAAGCACCTTCTGG - Intronic
995884610 5:116879945-116879967 CTGGAGGAGAAAGACACTGCTGG - Intergenic
998192448 5:140038386-140038408 CTGGAGAATAAAGATCTTGCTGG - Intronic
1001042496 5:168346995-168347017 CTGCAGAAAACAGCAGCTGCAGG - Intronic
1001778386 5:174346443-174346465 CTAGAGAAGAAAGCCACTCCAGG - Intergenic
1002108581 5:176892741-176892763 CTGGATAATAAGGCCGCTCCAGG + Intronic
1005027994 6:21482447-21482469 ATGGAGAATAGAGCAGCTGCAGG + Intergenic
1009494157 6:64328272-64328294 CTGGAGAACAATGCACCTGCAGG + Intronic
1014348921 6:120314165-120314187 CTGAGGAATAAAGCAGATGCTGG - Intergenic
1019490693 7:1311865-1311887 CTGGAGGAGACAGCCGCGGCCGG - Intergenic
1019766795 7:2857492-2857514 CTAGATAATAAAGCAGCTCCTGG - Intergenic
1023262865 7:38375640-38375662 CTGGAGAAGAAGGCTGCTGCGGG + Intergenic
1038874446 8:31532622-31532644 CAGGAGAATAAAGCTTCTCCTGG - Intergenic
1042057244 8:64777730-64777752 TTGGAGATGAAACCCGCTGCAGG - Intronic
1042560734 8:70070816-70070838 CTGAAGAATGAAGCCCCTTCAGG + Intronic
1045030272 8:98128294-98128316 TTGGAGAATAAACAGGCTGCTGG - Intronic
1045120780 8:99031875-99031897 TTGGAGAATGAAGCAACTGCTGG - Intronic
1048555564 8:135472540-135472562 TTGGAGAATAAAGCTAATGCAGG + Intronic
1049851139 8:144831187-144831209 CTGGAGAAGCAAACTGCTGCTGG - Intronic
1052650069 9:31290913-31290935 CTGGAGGATGAAGCCACTGGTGG + Intergenic
1055923761 9:81488999-81489021 CTGGTGAATAAAGCCCCAGAGGG + Intergenic
1057026043 9:91734352-91734374 CTGGAGGACACAGCCTCTGCTGG - Intronic
1057522519 9:95771556-95771578 CTGGAGAATAAACCAGCAGGCGG + Intergenic
1059389757 9:113991656-113991678 ATGGGGAATAAAGTCGGTGCAGG + Intronic
1203778147 EBV:85519-85541 CTTGAGCGTCAAGCCGCTGCGGG + Intergenic
1188694809 X:33177220-33177242 CTGGAGAAGGAAGCAGCTGTGGG + Intronic
1200535288 Y:4389950-4389972 CTGGAGAATACAGACGGTGGTGG + Intergenic