ID: 1169343420

View in Genome Browser
Species Human (GRCh38)
Location 20:4812812-4812834
Sequence CATGCAGCCCAGTGCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 295}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169343417_1169343420 -5 Left 1169343417 20:4812794-4812816 CCCAGGTGGCACAGCCGACATGC 0: 1
1: 0
2: 0
3: 10
4: 85
Right 1169343420 20:4812812-4812834 CATGCAGCCCAGTGCTCCTGTGG 0: 1
1: 0
2: 5
3: 29
4: 295
1169343418_1169343420 -6 Left 1169343418 20:4812795-4812817 CCAGGTGGCACAGCCGACATGCA 0: 1
1: 0
2: 1
3: 7
4: 75
Right 1169343420 20:4812812-4812834 CATGCAGCCCAGTGCTCCTGTGG 0: 1
1: 0
2: 5
3: 29
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169343420 Original CRISPR CATGCAGCCCAGTGCTCCTG TGG Intronic
900830383 1:4961100-4961122 CCAGCAGCCAAGAGCTCCTGAGG + Intergenic
900951010 1:5858344-5858366 CATGGAGCCCAGTCCTCGTGGGG - Intergenic
901046983 1:6402804-6402826 CAAGCAGCCCTGGGGTCCTGGGG + Intergenic
901197919 1:7450551-7450573 CCTGCAGCCCCGGGCACCTGTGG - Intronic
901203454 1:7479833-7479855 CACATAGCCAAGTGCTCCTGTGG + Intronic
901495499 1:9619076-9619098 CATGCAGTCCAGCGGTCATGAGG - Intergenic
901632797 1:10656123-10656145 CATCCCGCCCAGTGCACCTCTGG + Intronic
901663433 1:10813167-10813189 CCCCCAGCCCAGTTCTCCTGGGG + Intergenic
901665538 1:10824186-10824208 CCAGCAGCTCAGTGCCCCTGTGG - Intergenic
901810330 1:11763795-11763817 CACTCCGCCCAGTGCTCCAGGGG + Intronic
903218436 1:21855550-21855572 CCTGCTGCCCAGCGCTGCTGTGG + Exonic
903662050 1:24984330-24984352 CTTCCAGCCCTGGGCTCCTGGGG - Intergenic
904340688 1:29832535-29832557 CCTGCAGCCCAGCCCTGCTGGGG + Intergenic
904454916 1:30641748-30641770 CCTGCAGCCCAGCTCTGCTGGGG - Intergenic
906057444 1:42928091-42928113 CCTGCAGCACAGTCCGCCTGTGG + Intronic
908010247 1:59769055-59769077 CATGAAGCCCTGAGCACCTGGGG + Intergenic
908864475 1:68531002-68531024 CATGCAGCCCAGGAGTGCTGAGG + Intergenic
908901607 1:68962838-68962860 CATGTAGCCCAGGTCTTCTGTGG - Intergenic
911063608 1:93768686-93768708 CAGCCAGCCCAGGGCCCCTGTGG + Intronic
914884667 1:151575063-151575085 CATACAGCCTGTTGCTCCTGTGG + Intronic
916749178 1:167708991-167709013 CATCCAGCACAGGGCTCATGGGG - Intergenic
916842531 1:168614870-168614892 CATGGAGCCCAGTGACACTGTGG + Intergenic
917107635 1:171509345-171509367 CCTTCAGCTCAGTACTCCTGAGG - Intronic
917144122 1:171869315-171869337 CAAGCAGCCCACAGCTCCTCAGG - Intronic
918272896 1:182920292-182920314 CATGCAGCCCAGTAGTACTGAGG + Intronic
918328905 1:183437214-183437236 CATGTATCGCTGTGCTCCTGTGG - Intergenic
918683111 1:187379757-187379779 CACGATGCCCAGTGCTTCTGAGG - Intergenic
918863132 1:189859597-189859619 CATACATCCAAGTGTTCCTGCGG - Intergenic
920510639 1:206549412-206549434 CAGGCAGCCCACTGCTTCTAGGG - Intronic
921222054 1:212980314-212980336 AATGGAGGCCAGTGTTCCTGAGG + Intronic
921625289 1:217372749-217372771 CAGGCATCCCTGTGCTCTTGGGG + Intergenic
921675125 1:217968303-217968325 CAGGCATCCCAGTGCTCTTGGGG + Intergenic
923109025 1:230876371-230876393 CATTGAGCCCACTGCTCCTGTGG + Intergenic
923297611 1:232610396-232610418 CGTCCAGCCCAGTGCTGGTGGGG - Intergenic
923539115 1:234875695-234875717 CATGGGGCCCATGGCTCCTGAGG + Intergenic
924586292 1:245363965-245363987 CATGGAGCTCAGTGCTCCGCCGG - Intronic
924740400 1:246791436-246791458 CATGGGGCCCAGGGATCCTGTGG + Intergenic
1063371178 10:5523998-5524020 CATGCTGCCCGGAGCTCCTGGGG + Exonic
1064018126 10:11788319-11788341 CATGCAGCCTGGTGCACCCGTGG + Intergenic
1064434111 10:15295774-15295796 CAAGTAGCCCAGCACTCCTGTGG + Intronic
1065201558 10:23317358-23317380 CAGGCATCCCTGTGCTCTTGGGG - Exonic
1065478834 10:26171716-26171738 CATCCAGCCTCCTGCTCCTGAGG - Intronic
1065870275 10:29950436-29950458 CATCCAGCCGGGTGCTGCTGTGG - Intergenic
1068060768 10:52064662-52064684 CAGGCATCCCTGTGCTCCTGGGG - Intronic
1069398580 10:68017200-68017222 GAGGCAGCCCACTGCTCCTCTGG + Intronic
1070401486 10:76056785-76056807 CAGGCATCCCTGTGCTCTTGGGG - Intronic
1072735738 10:97878150-97878172 CATGGAGCCCACTGCTCCCCAGG - Intronic
1073446196 10:103582067-103582089 CAATCAGTCCAGAGCTCCTGGGG - Intronic
1073471991 10:103728136-103728158 CCTGCAGCCCTGAGGTCCTGAGG - Intronic
1074259165 10:111834489-111834511 CCTGGAGTCCAGCGCTCCTGGGG - Intergenic
1075050206 10:119178003-119178025 CATGGTGGTCAGTGCTCCTGGGG - Intronic
1075062934 10:119269392-119269414 CATGCAGCCGAGGGTTCCTGGGG + Intronic
1076478859 10:130770556-130770578 CCTGCAGTCCTGTGCTCCCGAGG - Intergenic
1076571256 10:131434618-131434640 CAGGCAGCCCGGGGGTCCTGGGG - Intergenic
1076577429 10:131478968-131478990 AATGCCACCCAGTGATCCTGGGG + Intergenic
1077370575 11:2179882-2179904 CCTGCCACCCTGTGCTCCTGAGG + Intergenic
1078526218 11:12103573-12103595 CCTGGAGCCCAGTCCTGCTGGGG + Intronic
1078573025 11:12475760-12475782 CATGCAGCCCCTTGCTCCCCTGG + Intronic
1080418878 11:32092819-32092841 CAGCCATCCCTGTGCTCCTGGGG + Intronic
1080662316 11:34307151-34307173 CCTGCAGGCCTGTGCTTCTGTGG + Intronic
1081112179 11:39149668-39149690 CATGAAGCCCAGTGACACTGTGG - Intergenic
1081710197 11:45211269-45211291 CATGCCTCCCAGGGGTCCTGGGG - Intronic
1081801253 11:45860842-45860864 CATTCAGCTCAATGATCCTGGGG - Exonic
1083312122 11:61789294-61789316 CCTGCACCCCTGTGCTCCTGGGG + Intronic
1084647602 11:70467708-70467730 CAGAGAGCCCAGGGCTCCTGTGG + Intergenic
1084991048 11:72925959-72925981 CAAGCCTCCCTGTGCTCCTGGGG + Intronic
1085212284 11:74791752-74791774 CAGGCATCCCTGTGCTCTTGGGG - Intronic
1085947585 11:81290586-81290608 CCTGCAGCCCCTTGCTTCTGAGG + Intergenic
1086595615 11:88567232-88567254 CATGCAGCCTAGGGCCACTGTGG + Exonic
1088650986 11:111958146-111958168 CAGGCATCCCTGTGCTCTTGTGG + Intronic
1088651011 11:111958236-111958258 CAGGCATCCCTGTGCTCTTGGGG + Intronic
1088920492 11:114257171-114257193 CTTTCAGCCCTGTTCTCCTGGGG + Intergenic
1089683126 11:120130522-120130544 CCTGCTGTCCTGTGCTCCTGGGG - Intronic
1089890487 11:121875725-121875747 CTTCCAGCACAGTTCTCCTGAGG + Intergenic
1090567348 11:128008949-128008971 TATGAATCTCAGTGCTCCTGTGG - Intergenic
1091591300 12:1844375-1844397 CACACAGCCCGGTGCTCCCGGGG - Intronic
1092909615 12:13135462-13135484 AATGCAGCCAAGTGCCCCTGGGG + Intronic
1092953243 12:13526894-13526916 CAGGCTGCCCACTGATCCTGTGG - Intergenic
1096460281 12:51818464-51818486 CCGGCAGCCCACTGCTTCTGAGG + Intergenic
1100798955 12:98211498-98211520 CAATCAGCCCTATGCTCCTGTGG + Intergenic
1101784955 12:107874733-107874755 CATCCAGACCAGGGCTGCTGAGG + Intergenic
1101998354 12:109541056-109541078 TATGCAGCCTTGCGCTCCTGGGG + Intergenic
1102426430 12:112847861-112847883 CATTCACCCCAGAGCTGCTGTGG + Intronic
1103003108 12:117401223-117401245 CCAGCAGGCCAGTACTCCTGAGG - Intronic
1103343725 12:120235444-120235466 CAGGCAGCGCAGTCCTCGTGGGG - Intronic
1103493981 12:121346611-121346633 CATGCAGGCAAGTGATCCAGAGG + Intronic
1103955307 12:124573086-124573108 CAGCCAGCCCAGGGCTCTTGAGG - Intergenic
1104270942 12:127281799-127281821 CTTCCAGCCCAGGGCTCTTGGGG - Intergenic
1104946215 12:132415898-132415920 CCTGCAGCCCCGTCCTCCAGTGG - Intergenic
1105518232 13:21109500-21109522 CAGGGAGCCCAGAGCTCCTCAGG - Intergenic
1105954614 13:25268853-25268875 CAGGCATCCCTGTGCTCTTGGGG + Intronic
1106687305 13:32074468-32074490 CATTCAAACCAGTGCTCCTGTGG - Intronic
1107130512 13:36889255-36889277 CAGGAAACCCAGTGTTCCTGTGG - Intronic
1108249505 13:48550801-48550823 CAGGCATCCCTGTGCTCTTGGGG + Intergenic
1108854513 13:54775893-54775915 CAGGCATCCCTGTGCTCTTGGGG - Intergenic
1109563391 13:64078807-64078829 CAGGCATCTCTGTGCTCCTGGGG - Intergenic
1111981592 13:95021858-95021880 CATTCAGCCCAGCCCTGCTGAGG - Intronic
1112509671 13:99997995-99998017 CACCCAGCCCAGGGCCCCTGTGG + Intergenic
1112621624 13:101059055-101059077 CATGGAGCCTGGTGCTGCTGGGG + Intronic
1113505407 13:110812903-110812925 CAGGCAGCGCGGTCCTCCTGGGG - Intergenic
1113815220 13:113165046-113165068 AATGCAGACCAGTGTGCCTGCGG + Exonic
1113963908 13:114141036-114141058 CACTCAGCCCAGTTCCCCTGAGG - Intergenic
1114769319 14:25410584-25410606 CCTGCAGCAGAGTGCTCCTGGGG + Intergenic
1118543422 14:66857806-66857828 CATGCAGCCAGTTGCTGCTGGGG - Intronic
1119225742 14:72943483-72943505 CCTGCAGCCCAGTGTGCCTTTGG + Intronic
1120778963 14:88468597-88468619 CATGCTGCCCAGAGCCCTTGAGG - Intronic
1121090432 14:91177864-91177886 CATGGAGCACTGTACTCCTGAGG - Intronic
1122470182 14:101961079-101961101 CATGCACCCCACTGCCCATGGGG - Intergenic
1123448432 15:20345646-20345668 GATGCAGCCCCCAGCTCCTGGGG - Intergenic
1124019224 15:25904180-25904202 CCTGCAGCCCAGGGGTCATGAGG - Intergenic
1124344746 15:28914685-28914707 CGTGCAGCCCAGGAATCCTGGGG - Intronic
1124564606 15:30801697-30801719 CCTGCAGCCCCAAGCTCCTGGGG - Intergenic
1128651149 15:69414588-69414610 CATCCCGCCCGGTGCTGCTGCGG + Intronic
1129110449 15:73334149-73334171 CCTGCAGCCCAGTACCACTGGGG + Intronic
1130273195 15:82463030-82463052 GATGCAGCCCTGTGCTGCGGTGG - Intergenic
1130465547 15:84190401-84190423 GATGCAGCCCTGTGCTGCGGTGG - Intergenic
1130487145 15:84404419-84404441 GATGCAGCCCTGTGCTGCGGTGG + Intergenic
1130498718 15:84483135-84483157 GATGCAGCCCTGTGCTGCGGTGG + Intergenic
1130587836 15:85194996-85195018 GATGCAGCCCTGTGCTGCGGTGG - Intergenic
1130938818 15:88491185-88491207 CATGCTCCTCGGTGCTCCTGAGG - Intergenic
1132671730 16:1104732-1104754 CATTCAGCCCTGAGCTCCCGGGG - Intergenic
1132836150 16:1954401-1954423 ACTGCAGCCAAGGGCTCCTGGGG + Intronic
1133282854 16:4676984-4677006 CCTGCAGCCAAGAGCTCCTCTGG + Intronic
1133321316 16:4915300-4915322 CAAGCAGCCCAGTGGGCCTTGGG - Intronic
1135112121 16:19698489-19698511 CATGAATCCCGGTGCTGCTGTGG - Intronic
1137003278 16:35250502-35250524 CATGAAGGCCATAGCTCCTGAGG + Intergenic
1138693819 16:58792769-58792791 CATGCAGCACTGAGCTCCTGGGG - Intergenic
1138726521 16:59146285-59146307 AAAGCTGCACAGTGCTCCTGTGG - Intergenic
1140583430 16:76257688-76257710 CACACAGCACAGTGCTCCTGGGG - Intergenic
1142324745 16:89407393-89407415 GAGGCAGCCCAGTGTTGCTGGGG - Intronic
1142352594 16:89586940-89586962 CAGGCAGCCCAGTCCCTCTGGGG - Intronic
1144081719 17:11769331-11769353 TAAGCAGCCCAGGGCACCTGGGG + Intronic
1144762984 17:17717783-17717805 CATGCAGCCTCCTTCTCCTGGGG - Intronic
1145304562 17:21666234-21666256 CCTGCAGCCCAGGGCTCCTGTGG - Intergenic
1146425187 17:32731790-32731812 CAGGCATCCCTGTGCTCTTGGGG + Intronic
1147564801 17:41529458-41529480 AAAGCAGCCCAATACTCCTGTGG - Intergenic
1148698085 17:49573093-49573115 CAGGGTGCCCAGTGCTCCTCTGG + Intergenic
1150492531 17:65584256-65584278 CATGCAGCCCTGCACTGCTGGGG + Intronic
1151887146 17:76929800-76929822 CATTAAGCCAAGAGCTCCTGGGG - Intronic
1151927041 17:77205582-77205604 TCTGCAGCCCTGGGCTCCTGCGG - Intronic
1152178055 17:78800714-78800736 CTTGCAGTCCTGTGCACCTGAGG - Intronic
1152340357 17:79720936-79720958 GATGCAGCCCCCAGCTCCTGGGG + Intergenic
1152409231 17:80113428-80113450 CAGGCAGCCCTGTCCTGCTGTGG + Intergenic
1153273851 18:3349315-3349337 ACTGCAGCCCCGAGCTCCTGGGG - Intergenic
1155591274 18:27429570-27429592 CCTGGATCCCAGTGCTGCTGTGG + Intergenic
1156160250 18:34350751-34350773 CAGGCAGCCCTGTACTCTTGGGG + Intergenic
1158787940 18:60739451-60739473 CAAGCATCCCTGTGCTCTTGGGG + Intergenic
1160397559 18:78583490-78583512 TCTCCAGCCCCGTGCTCCTGAGG + Intergenic
1160397570 18:78583529-78583551 TCTCCAGCCCCGTGCTCCTGAGG + Intergenic
1161370477 19:3908424-3908446 CTTGCAGCCTGGTGCCCCTGTGG - Intronic
1161516942 19:4701928-4701950 CATGCAGCTCAGAGGGCCTGGGG + Intronic
1161767757 19:6216497-6216519 CATGGAGCGCAGGGGTCCTGGGG + Exonic
1162016695 19:7850133-7850155 CCTGCAGCCCTGCTCTCCTGCGG - Intronic
1162456838 19:10790257-10790279 CATGTATCCCAGTGCCCATGGGG + Intronic
1162786876 19:13040543-13040565 CCTGGAGGCCAGGGCTCCTGAGG - Intronic
1164573320 19:29389741-29389763 CATGGAGCCCAGTGCTGCCAGGG + Intergenic
1164608342 19:29615997-29616019 CATGCAGTACTCTGCTCCTGGGG - Intronic
1166850609 19:45758875-45758897 CAGGGAGCCCACTGTTCCTGGGG + Exonic
925197157 2:1935292-1935314 CATGCAACCCAGTGCCCTTCTGG + Intronic
926308534 2:11657822-11657844 CATGCAGCCCAGTTATGCTCTGG - Intergenic
926329778 2:11814842-11814864 CATCCAGCCATGTTCTCCTGAGG + Intronic
926797769 2:16632927-16632949 CCTGCAGCCCTGTGCTATTGGGG - Intronic
927013704 2:18933519-18933541 CCTGGATCCCATTGCTCCTGAGG + Intergenic
928436207 2:31256161-31256183 CACCCAGGCCAGTGCTCCTCTGG + Intronic
929676895 2:43943504-43943526 CTAGCAGCCCTGTGGTCCTGTGG - Intronic
931233311 2:60392377-60392399 AACGCAGGCCAGTGCTCCAGAGG + Intergenic
932144934 2:69308235-69308257 CAACCAGCGCTGTGCTCCTGGGG + Intergenic
932411644 2:71551206-71551228 CATGCAGGCCTGGGCTCCTGAGG - Intronic
933291689 2:80444987-80445009 CACGTTGCCCAGTGCCCCTGGGG + Intronic
933319011 2:80748396-80748418 CCTGCAATCCAGTGCTCCCGGGG + Intergenic
933624785 2:84586178-84586200 CAGGCAGTCCTGTGCTCTTGGGG - Intronic
934673500 2:96232245-96232267 CATCCAGCCTAGTGATCCTGTGG + Intergenic
936339391 2:111617957-111617979 CAGGAACTCCAGTGCTCCTGGGG + Intergenic
937041769 2:118827166-118827188 CTACCAGCACAGTGCTCCTGGGG - Intergenic
937079840 2:119133095-119133117 AATGCGTCCCAGTGGTCCTGGGG - Intergenic
937215965 2:120313840-120313862 GATGGAGCCCGGTGCTCCTCGGG - Intergenic
938604985 2:132883124-132883146 CATGCAGCCTTGACCTCCTGGGG - Intronic
938791303 2:134678682-134678704 CTTGCAGCCCAGTCGACCTGGGG - Intronic
940899206 2:159110889-159110911 CATGCAGCACAGCCCTCCTTCGG + Intronic
941998781 2:171626469-171626491 CAGGCATCCCTGTGCTCTTGGGG + Intergenic
942585183 2:177466915-177466937 CAGGCATCCCTGTGCTCTTGGGG - Intronic
944154070 2:196592930-196592952 CATGCAGCTCACGGCTGCTGCGG + Intronic
946249342 2:218403179-218403201 CATGCAGCCCAATGAACCTGCGG + Intronic
946951404 2:224879257-224879279 CATCTACCCCAGTCCTCCTGGGG - Intronic
948707685 2:239805171-239805193 CCCCCAGCCCAGTGCACCTGAGG + Intergenic
948877847 2:240839681-240839703 AATGCACCCCAGAGTTCCTGGGG + Intergenic
1169100944 20:2948587-2948609 CAGGCAGCCCAGCAGTCCTGAGG - Intronic
1169343420 20:4812812-4812834 CATGCAGCCCAGTGCTCCTGTGG + Intronic
1169529220 20:6466105-6466127 CATTCTGCCCAGTGCTTCTTGGG + Intergenic
1169656921 20:7934508-7934530 CATGCAGCGCATGGCTCATGTGG - Exonic
1169846569 20:9999696-9999718 CATGCAGCCCAGGCCTTCTCAGG - Intronic
1170221454 20:13946706-13946728 CAGGCATCCCTGTGCTCTTGGGG + Intronic
1170311402 20:14996642-14996664 CAAGCAGCCCACTGCTGCTGGGG - Intronic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1171153741 20:22852130-22852152 CATACAGCCAGGTGCTCCTCTGG + Intergenic
1171522078 20:25783673-25783695 CCTGCAGCCCAGGGCTCCTGTGG - Intronic
1171529829 20:25845618-25845640 CCTGCAGCCCAGGGCTCCTGTGG - Intronic
1171554749 20:26072210-26072232 CCTGCAGCCCAGGGCTCCTGTGG + Intergenic
1172363528 20:34331699-34331721 ACTGCAGCCTAGAGCTCCTGGGG - Intergenic
1174584035 20:51593542-51593564 CCTGCAGCCCTCTGCTCCAGTGG + Intergenic
1175138451 20:56842366-56842388 CAGGCATTCCTGTGCTCCTGGGG + Intergenic
1176097939 20:63352846-63352868 GATGCAGCCCAGGGGTGCTGTGG - Intronic
1177262434 21:18748563-18748585 CAGGCATCCCTGTGCTCTTGGGG - Intergenic
1178099051 21:29246348-29246370 CATGCAGCCTTGACCTCCTGGGG + Intronic
1180047611 21:45317079-45317101 AATGCAGCCAAAAGCTCCTGTGG + Intergenic
1180761994 22:18217529-18217551 GAGGCAGTCCAGTTCTCCTGAGG + Intergenic
1180773673 22:18407081-18407103 GAGGCAGTCCAGTTCTCCTGAGG - Intergenic
1180805022 22:18656625-18656647 GAGGCAGTCCAGTTCTCCTGAGG - Intergenic
1180805721 22:18712783-18712805 GAGGCAGTCCAGTTCTCCTGAGG + Intergenic
1180963378 22:19772980-19773002 CCTGCACCCGAGTGCTGCTGGGG + Intronic
1181069729 22:20325798-20325820 GAGGCAGTCCAGTTCTCCTGAGG - Intergenic
1181192772 22:21154006-21154028 GAGGCAGTCCAGTTCTCCTGAGG - Intergenic
1181216670 22:21338568-21338590 GAGGCAGTCCAGTTCTCCTGAGG + Intergenic
1181308532 22:21930929-21930951 TATGGAGCCCAGAGCTCCGGGGG - Intronic
1183431642 22:37769396-37769418 CAGGCAGCCCAGTGGTTCTCGGG + Intronic
1184365439 22:44048031-44048053 CATCCCGCCCACTGGTCCTGTGG - Intronic
1184422524 22:44390290-44390312 CATCCATCCCAATGCTCCTTTGG - Intergenic
1203235503 22_KI270731v1_random:148055-148077 GAGGCAGTCCAGTTCTCCTGAGG - Intergenic
949304855 3:2628309-2628331 CCTGCTGCTCAGTGTTCCTGCGG - Intronic
950666361 3:14497690-14497712 CCTGCAGCCCAGTCTTCATGTGG - Intronic
951264819 3:20552887-20552909 CAGGCATCCCTGTGCTCTTGGGG - Intergenic
951333953 3:21398889-21398911 CTTGGAGCCCAGGGCTGCTGAGG + Intergenic
953979294 3:47405743-47405765 CATGGAGTGCAGCGCTCCTGGGG - Exonic
954381050 3:50219305-50219327 CTTGGAGTCCAGTGATCCTGGGG - Intronic
954636566 3:52074123-52074145 CAGGCAGCCCAGTGCTGGTCTGG + Intergenic
955060948 3:55490980-55491002 CATGAAGCTTATTGCTCCTGGGG - Intergenic
955539958 3:59964340-59964362 CACGCAGCCCATTGTTCATGGGG - Intronic
955608247 3:60730140-60730162 CAAACAGCCCAGTGGTCCTTCGG - Intronic
956882130 3:73521154-73521176 CCGGCAACCCAGTGCTCCTGAGG - Intronic
957306753 3:78467421-78467443 CATACAGGCCAGTGCCCCTCTGG - Intergenic
961026567 3:123563508-123563530 CATGCTCCACACTGCTCCTGTGG - Intronic
961356582 3:126343495-126343517 CCTCCAGCCCCGTGCGCCTGGGG + Exonic
961766344 3:129214195-129214217 AATGCAGCCTCGAGCTCCTGGGG + Intergenic
961943084 3:130657080-130657102 CAGGCATCCCTGTGCTCTTGGGG - Intronic
962914034 3:139882818-139882840 CATACAGCCAGGTGCTCCTCTGG - Intergenic
964064071 3:152559608-152559630 CCAGCAGGCCAGTGCTGCTGGGG - Intergenic
967485554 3:190026310-190026332 AATGCAGCCCAGTACGCCTCAGG - Intronic
968558745 4:1265033-1265055 CAAGCAGCCCGGCTCTCCTGAGG - Intergenic
969587760 4:8104360-8104382 CGTGAAGCCCAGTCCTCATGGGG - Intronic
969674947 4:8609554-8609576 CTTGCACCCCTGTGCTCTTGGGG + Intronic
971394720 4:26217352-26217374 CATTCAGCTGTGTGCTCCTGTGG + Intronic
972230767 4:37070288-37070310 CATGGACCACAGTGCTGCTGTGG - Intergenic
973631537 4:52825106-52825128 CATGCAGAGCAGTGCTGCAGAGG - Intergenic
974420032 4:61662210-61662232 CAAGCATCCCTGTGTTCCTGAGG + Intronic
981119776 4:141036629-141036651 CATGCAGCCCACTGATGCTTTGG - Intronic
981347936 4:143698116-143698138 CATGCAGCTCATTACTGCTGAGG + Exonic
983491746 4:168397918-168397940 CAGGCATCCCTGTGCTCTTGGGG + Intronic
985482314 5:121663-121685 TCTGAAGCCCAGTGCTTCTGAGG - Intergenic
986910423 5:12548962-12548984 CATGCAGCCCAGTGGGTCTTGGG - Intergenic
987978410 5:25046290-25046312 CTTGCAGCCTACTTCTCCTGGGG - Intergenic
992172063 5:74112679-74112701 CATGCCTCCCACTGCTCCTCTGG + Intergenic
996659293 5:125981210-125981232 GATCCAGCCCAGTGCTGCTTTGG + Intergenic
996748543 5:126867012-126867034 CATGAAGCCTGGTGCTGCTGAGG - Intergenic
998179118 5:139924078-139924100 CATCCATCCTAGTGATCCTGGGG - Intronic
999250337 5:150178603-150178625 ACTGGAGCCCAGGGCTCCTGGGG + Intronic
999732690 5:154486628-154486650 CAAGCAGCCCAGAGCTCTTGTGG - Intergenic
1001980211 5:176033181-176033203 CAGGCACCCCAGTGCCTCTGGGG - Intronic
1002237172 5:177810482-177810504 CAGGCACCCCAGTGCCTCTGGGG + Intergenic
1002443263 5:179275115-179275137 TAGGCAGCCCAGGGCTTCTGGGG + Intronic
1003221361 6:4163706-4163728 CTTGCTGCTCAGTGCTGCTGAGG - Intergenic
1004424520 6:15498344-15498366 CATGCAGACCCTTGCTCCTCAGG + Intronic
1004477569 6:15988217-15988239 AAGGCAGCCCAGTGCACCTATGG + Intergenic
1006510106 6:34516889-34516911 CAGGCCTCTCAGTGCTCCTGGGG - Intronic
1011307211 6:85941319-85941341 CATGAAGCTCAGGGCTCCTAGGG + Intergenic
1012382017 6:98631354-98631376 CATGCAGCCCGAGGCTCCTACGG + Intergenic
1012752666 6:103183755-103183777 CAGGCATCCCTGTGCTCTTGGGG + Intergenic
1013171664 6:107641760-107641782 CATGCAGACAAGTGCTGCAGAGG + Intronic
1014841361 6:126224422-126224444 AATGCAGCCCAGTAGTACTGAGG - Intergenic
1015378130 6:132534139-132534161 GATACATCCCAGTGGTCCTGAGG - Intergenic
1015803868 6:137089424-137089446 GCTGCAGGCCAGTGCTGCTGGGG - Intergenic
1016266524 6:142238789-142238811 CATGAAGCCCAGTGCCCTTTAGG - Intergenic
1017995825 6:159531017-159531039 CAGGCAGCTCAGTGCTTCTGAGG + Intergenic
1018710292 6:166493953-166493975 CATGGAGGCCAGTGGTACTGGGG + Intronic
1019154532 6:170030181-170030203 CCTGCAGTCCTGTGGTCCTGTGG + Intergenic
1019262661 7:90329-90351 CCTGCTGCCCTGTTCTCCTGTGG - Intergenic
1019729765 7:2623441-2623463 CTTGCTGCCCCGTGCTCCGGGGG + Intergenic
1019900145 7:4013985-4014007 CCTGCGGCCGAGGGCTCCTGTGG + Intronic
1025282572 7:57638848-57638870 CCTGCAGCCCAGGTCTCCTGTGG - Intergenic
1025302151 7:57826562-57826584 CCTGCAGCCCAGGGCTCCTGTGG + Intergenic
1026603096 7:71792900-71792922 CTTGCAGCCCCGCTCTCCTGGGG - Intronic
1027267588 7:76502819-76502841 CAGTCAGCACAGTGCTCATGAGG + Intronic
1027319399 7:77002684-77002706 CAGTCAGCACAGTGCTCATGAGG + Intergenic
1027348029 7:77281948-77281970 CATGCAGACCAGAGCTGCTGGGG + Intronic
1029599913 7:101557612-101557634 CCTGGAGCCCAGTTCCCCTGGGG - Exonic
1030358598 7:108570206-108570228 CATGCAGCCCATTGTCCCTGCGG - Intronic
1033654295 7:143362592-143362614 GATGCAGCCCATGGCTCCGGGGG + Exonic
1034896115 7:154877602-154877624 CATGGAGCCAGGTGCTACTGAGG - Intronic
1035319133 7:158017319-158017341 CAGGGAGTCCAGTGCTCCTGAGG + Intronic
1035443355 7:158922133-158922155 CATGCAGCCCAAGACACCTGTGG - Intronic
1036757389 8:11480394-11480416 AAAGAAGCCCAGTTCTCCTGAGG - Intergenic
1037402048 8:18503300-18503322 CCCGCAGCCCAGTGCTCCAGGGG - Intergenic
1041090908 8:54300060-54300082 CAGGCGGCCCTGTGTTCCTGTGG + Intergenic
1041956285 8:63560275-63560297 CAGGCATCCCTGTGCTCTTGAGG - Intergenic
1042192322 8:66199697-66199719 CATGAATCCCAGAACTCCTGGGG - Intergenic
1043151658 8:76724826-76724848 CATGTAACCCAGTGGGCCTGTGG - Intronic
1043758230 8:84031360-84031382 CAAGCATCCCTGTGCTCTTGGGG + Intergenic
1047334880 8:123925952-123925974 CATGGAGCCCAGTGCACAAGTGG + Intronic
1048180595 8:132190864-132190886 CATGCAGCCCAGACCTCCCTTGG - Intronic
1048239234 8:132724638-132724660 CAATCATCACAGTGCTCCTGAGG + Intronic
1048976284 8:139674753-139674775 CAAGCACCCCAGTGACCCTGGGG + Intronic
1049249338 8:141579852-141579874 CATGTGGCCCAGAGGTCCTGTGG - Intergenic
1049425926 8:142537852-142537874 CCTGCAGCCTTGTGCCCCTGGGG + Intronic
1049778864 8:144418381-144418403 CAGCCAGCCCATTGGTCCTGGGG - Intergenic
1049804560 8:144533020-144533042 GAAGCAGCCCAGTGGGCCTGAGG + Intronic
1051310038 9:15760215-15760237 CATGCACCACAGTTTTCCTGGGG - Intronic
1053452069 9:38201793-38201815 CATGCAGCCCTCTGCTGCTGTGG - Intergenic
1054856836 9:69909444-69909466 CATGGACACCAGTGCTCCAGAGG + Intergenic
1057020935 9:91697349-91697371 CCTGCAGCCCAGGGCCCCTTTGG + Intronic
1057638455 9:96794700-96794722 CATGCAGTCCAGGAGTCCTGAGG - Intergenic
1060983878 9:127808818-127808840 CATCCAGGCCAGGGCTCCTGTGG + Exonic
1061661248 9:132131724-132131746 CATGCAGCCCAGCTCTGCTCAGG - Intergenic
1062026028 9:134341203-134341225 CCTGCACCCCAGTGCTGATGAGG + Intronic
1062293852 9:135813133-135813155 CATGCGGCCCAGGCATCCTGAGG + Intronic
1185461658 X:335464-335486 CAAGCAGCACAGGGCCCCTGCGG - Intronic
1186520128 X:10198843-10198865 CATGCAGTTCAGTTCTCCTTTGG + Intronic
1186999800 X:15164759-15164781 CATGCATCCCAGTTTACCTGTGG + Intergenic
1187726860 X:22212318-22212340 GATGGAGTCCTGTGCTCCTGGGG + Intronic
1188209197 X:27399040-27399062 CCTGCATCCCAGTGCTCTTCTGG - Intergenic
1189471134 X:41315193-41315215 CCCACAGCCCAGTGCTGCTGGGG - Intergenic
1189865536 X:45323432-45323454 CATGCAGCCATGTGCTTATGGGG + Intergenic
1192753410 X:74018934-74018956 CATGCAGCCCAGGAATCCTGAGG + Intergenic
1192988898 X:76428851-76428873 CGTGCAGCCCACTGCTGGTGAGG + Exonic
1193376471 X:80767314-80767336 CATACAGCCCGGTGCCCCTCTGG + Intronic
1197724698 X:129768648-129768670 CAAGAAGCCCTGTGTTCCTGGGG - Exonic
1197840151 X:130737743-130737765 CAGGCAGCCCAGGACACCTGAGG + Intronic
1199599298 X:149532338-149532360 CATGCAGCCCAGTGCAGCTCAGG - Intronic
1199850725 X:151723405-151723427 CATGCAAACCAGTGCTTGTGGGG + Intergenic
1199973751 X:152879414-152879436 AATGCATCCCTGTGATCCTGAGG + Intergenic
1202369682 Y:24188323-24188345 GATGCAGCCCTGTGCTGCAGTGG + Intergenic
1202501103 Y:25481794-25481816 GATGCAGCCCTGTGCTGCAGTGG - Intergenic