ID: 1169343546

View in Genome Browser
Species Human (GRCh38)
Location 20:4813366-4813388
Sequence CTGTGCAGACAGCTTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 245}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169343546_1169343562 27 Left 1169343546 20:4813366-4813388 CCCTGCCCAAGCTGTCTGCACAG 0: 1
1: 0
2: 3
3: 16
4: 245
Right 1169343562 20:4813416-4813438 AGATGGGAGGAAGCGGTCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 191
1169343546_1169343558 11 Left 1169343546 20:4813366-4813388 CCCTGCCCAAGCTGTCTGCACAG 0: 1
1: 0
2: 3
3: 16
4: 245
Right 1169343558 20:4813400-4813422 CAGACGCGACTGTGGAAGATGGG 0: 1
1: 0
2: 0
3: 1
4: 47
1169343546_1169343560 20 Left 1169343546 20:4813366-4813388 CCCTGCCCAAGCTGTCTGCACAG 0: 1
1: 0
2: 3
3: 16
4: 245
Right 1169343560 20:4813409-4813431 CTGTGGAAGATGGGAGGAAGCGG 0: 1
1: 1
2: 3
3: 85
4: 871
1169343546_1169343557 10 Left 1169343546 20:4813366-4813388 CCCTGCCCAAGCTGTCTGCACAG 0: 1
1: 0
2: 3
3: 16
4: 245
Right 1169343557 20:4813399-4813421 CCAGACGCGACTGTGGAAGATGG 0: 1
1: 0
2: 0
3: 4
4: 73
1169343546_1169343554 3 Left 1169343546 20:4813366-4813388 CCCTGCCCAAGCTGTCTGCACAG 0: 1
1: 0
2: 3
3: 16
4: 245
Right 1169343554 20:4813392-4813414 TGGGTTCCCAGACGCGACTGTGG 0: 1
1: 0
2: 0
3: 4
4: 129
1169343546_1169343559 14 Left 1169343546 20:4813366-4813388 CCCTGCCCAAGCTGTCTGCACAG 0: 1
1: 0
2: 3
3: 16
4: 245
Right 1169343559 20:4813403-4813425 ACGCGACTGTGGAAGATGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 91
1169343546_1169343561 26 Left 1169343546 20:4813366-4813388 CCCTGCCCAAGCTGTCTGCACAG 0: 1
1: 0
2: 3
3: 16
4: 245
Right 1169343561 20:4813415-4813437 AAGATGGGAGGAAGCGGTCCTGG 0: 1
1: 0
2: 1
3: 12
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169343546 Original CRISPR CTGTGCAGACAGCTTGGGCA GGG (reversed) Intronic
900339989 1:2183771-2183793 CTGTCAAGACAGCTTGGGCATGG - Intronic
900490897 1:2948656-2948678 CTCTCCAGAAAGCTGGGGCAAGG + Intergenic
900494287 1:2969441-2969463 CTCAGCAGACACCTTGGGGAGGG + Intergenic
901097577 1:6694506-6694528 CTCTGAAGTCAGCTTGGGGAAGG - Intronic
901201954 1:7472142-7472164 CTGTGCTGCCAGCGTGGGCCAGG - Intronic
901681189 1:10913800-10913822 CCATGCAGACAGGTTGTGCATGG - Intergenic
901921882 1:12542475-12542497 CTGTGAACTCCGCTTGGGCAGGG + Intergenic
902655796 1:17867270-17867292 CTGTGAGGCCACCTTGGGCAAGG - Intergenic
902754619 1:18540909-18540931 CTGTGCTGAAAGCCTGGGCTGGG - Intergenic
903608456 1:24592039-24592061 CTCTGGAGAGACCTTGGGCAGGG + Intronic
905910038 1:41647431-41647453 CTGTGGAAACAGCTTGTGCCCGG - Intronic
906237337 1:44219922-44219944 CTGTGGATATAGGTTGGGCAGGG + Intronic
906540392 1:46581220-46581242 CTGTTCAGAGAGGCTGGGCATGG + Intronic
906692632 1:47802646-47802668 TTGTGCAGACAGAATGAGCAGGG - Intronic
907485759 1:54777054-54777076 CTGTTCAGACAGCAGGGGCCAGG - Intergenic
909267304 1:73577114-73577136 CTGTGCAGAGATCCTGTGCAAGG + Intergenic
910682928 1:89885835-89885857 CTGTGGAGGCAGAATGGGCAAGG + Intronic
910867881 1:91804507-91804529 TTGTGCAGACAGATTGCGGAAGG - Intronic
910996524 1:93110304-93110326 CTGTAAAGACAGCTTGGTCAAGG - Exonic
911102334 1:94104584-94104606 CTGTCCATGCAGCTGGGGCAGGG + Intronic
911884019 1:103274638-103274660 CTGAGCACACACCTTGAGCAGGG + Intergenic
912195638 1:107394106-107394128 CTGGGCATCCAGCCTGGGCAGGG - Intronic
915557662 1:156669409-156669431 CTCTGAAGACCTCTTGGGCAGGG - Exonic
916246845 1:162696797-162696819 CTGGGCAGACAGCGGGGGCAGGG - Intronic
919839716 1:201600001-201600023 CCGAGGAGACAGCTTGGGCCCGG + Intergenic
920386330 1:205572382-205572404 CTGTTAAGAAAGCATGGGCAGGG - Intronic
921559492 1:216640108-216640130 CTGTGCAGTCTACTTGGGTAAGG + Intronic
922053290 1:222015837-222015859 TTTTGCAGACAGCTCTGGCAAGG - Intergenic
922724313 1:227915349-227915371 CTGTGTAGCCAGGTGGGGCAGGG + Intergenic
922807766 1:228399370-228399392 CTGGGCAGGGAGCTTGGCCAAGG + Intronic
1065791358 10:29263529-29263551 ATGGGCAGACAGCTGGGCCATGG - Intergenic
1065939246 10:30548953-30548975 ATGGGCAGACAACTTGGGCGGGG - Intergenic
1067292337 10:44952794-44952816 CTGGGAAGGCAGCTTGGGCATGG + Intergenic
1067838032 10:49653600-49653622 CTGTCCGGACACCTTGGGGAAGG + Intronic
1068096676 10:52499742-52499764 GTGTGCAGACTCCTTAGGCAGGG - Intergenic
1068662339 10:59635579-59635601 CTGTGCAGTAAGTTGGGGCAAGG - Intergenic
1070149777 10:73798493-73798515 CTGGGCAGGGAGGTTGGGCATGG + Intronic
1070586301 10:77769359-77769381 CTGTGCACTCAGCTTTAGCAGGG - Intergenic
1072438322 10:95433265-95433287 CTGTGAAGACAGCTGAGGCTCGG - Intronic
1072607548 10:96997454-96997476 CTGGGCAGGCAGGCTGGGCAGGG - Intergenic
1075122636 10:119675601-119675623 CTGTGCAGACAGTCTGCTCACGG - Intronic
1076443377 10:130495648-130495670 CTGGGCAGGGACCTTGGGCAAGG - Intergenic
1077453356 11:2663970-2663992 GTGGGCAGAGAGCTTGGGGATGG - Intronic
1078669614 11:13353324-13353346 CTGAGCATACAGCTTTGGGAGGG - Intronic
1079081393 11:17415723-17415745 CTGCACAAACAGCTGGGGCAAGG + Intronic
1079137323 11:17783236-17783258 CTCTGCAGATTGGTTGGGCAGGG + Intergenic
1079140677 11:17807476-17807498 CAGTGCAGACAGCCAGGGCCTGG - Intronic
1079444530 11:20546866-20546888 CAGAGCTGACAGCTTGGGCAAGG + Intergenic
1079454435 11:20624583-20624605 CTGTGCAGACAGCGTGCGGCAGG + Intronic
1080394869 11:31880896-31880918 CTGAAGAGACATCTTGGGCAAGG + Intronic
1080690078 11:34549130-34549152 CAGGGCACACAGTTTGGGCAGGG - Intergenic
1081249557 11:40813358-40813380 CAGGGCAGAGAGCTTGTGCAGGG + Intronic
1084461263 11:69297913-69297935 CTGAGCCCAGAGCTTGGGCAGGG - Intronic
1084474438 11:69380855-69380877 CAGTTCAGACAGCCTGGGCCAGG - Intergenic
1084506756 11:69573191-69573213 ATGAGCAGGCACCTTGGGCATGG - Intergenic
1085026979 11:73242086-73242108 GTGTGTAGAGAGCTGGGGCAAGG + Intergenic
1085445316 11:76597439-76597461 CTGGGTAGAGAGCCTGGGCAGGG - Intergenic
1089317780 11:117603986-117604008 CTGGGCAGACGACTTGGCCAGGG + Intronic
1089983887 11:122794909-122794931 CTTTGGAGACAGCAAGGGCAAGG - Intronic
1090188478 11:124753042-124753064 CTGGGTACACAGCTTGGGAAGGG + Intronic
1091672504 12:2462337-2462359 CTGTGCAGAGAGCTGAGCCAAGG - Intronic
1092917130 12:13199183-13199205 CTGGGCAGACCGCTGGGGAAAGG + Intronic
1094553879 12:31478605-31478627 GTGGGAAGACAGCTTGAGCACGG + Intronic
1096186030 12:49581108-49581130 GTGTGCAGAGAGCAGGGGCAGGG + Intronic
1096585088 12:52614754-52614776 CTGGGCAGCTAGCTAGGGCAGGG - Intronic
1097122959 12:56750073-56750095 CAGTGGAAACAGCTTGAGCAAGG + Intronic
1097330288 12:58325471-58325493 CTGTGCAGATAGCTTGAGCTAGG + Intergenic
1101330423 12:103753376-103753398 CTGTGCAGACAGAGTCTGCAGGG + Intronic
1102455530 12:113068612-113068634 CTGTGCAGACAGCTTGTGATGGG + Intronic
1102498973 12:113338285-113338307 CTGTGCTGGCAGCCTGGACATGG - Intronic
1102702433 12:114851119-114851141 ATGTGCAGACTGGTTGGGAAAGG - Intergenic
1104675721 12:130710680-130710702 CTGTCCACACAGCTAGGCCAAGG + Intronic
1105069755 12:133227359-133227381 CTGTGCAGACAGCCTGACCTGGG - Intronic
1105872417 13:24517177-24517199 CTGTGCAGACAGTGTGGGCACGG - Intergenic
1115992393 14:39163535-39163557 CTGTGGAGACAGATTAAGCAAGG - Intronic
1117831398 14:59754870-59754892 CTGTGAAGACAGCATGGCCTTGG - Intronic
1118753503 14:68822685-68822707 CTGTGGGGTCAGCTAGGGCAGGG - Intergenic
1120221931 14:81744240-81744262 TTGTCCAGACAACTTGGGCAAGG + Intergenic
1123125674 14:105944350-105944372 CTGTGCAGCCAGGATGGGCCGGG - Intergenic
1124159161 15:27253416-27253438 CTGAGTGGACAGCTTGGGGAGGG - Intronic
1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG + Intergenic
1124453932 15:29822863-29822885 CTGGGCAAACAGCATGGTCACGG + Intronic
1124620590 15:31271855-31271877 CTGGGCAGAGAGCCAGGGCAAGG - Intergenic
1125617297 15:41026260-41026282 CTGTGAAAACAGGCTGGGCACGG + Intronic
1125682907 15:41544068-41544090 CTGTGCATAGATCTCGGGCACGG - Intronic
1127844678 15:62858758-62858780 CTGTGCAGCTAGTTTCGGCAAGG - Intergenic
1129496125 15:75982826-75982848 GTGGGGAGACAGCTTGGGCTTGG - Intronic
1129737470 15:77974214-77974236 TGGTGCAGGCAGCCTGGGCATGG + Intergenic
1131890783 15:96969516-96969538 CTGTGCACCAAGCCTGGGCAGGG + Intergenic
1132745680 16:1435260-1435282 GAGTGCTTACAGCTTGGGCAGGG + Intronic
1132786568 16:1660129-1660151 CTGTGCTCTCAGCTTCGGCACGG - Intronic
1135322898 16:21508680-21508702 CTGAGCAGACAGGTGGGGCCAGG - Intergenic
1136334382 16:29601865-29601887 CTGAGCAGACAGGTGGGGCCAGG - Intergenic
1136573646 16:31110785-31110807 GTGGGCAGACATCTGGGGCAGGG + Intronic
1137251798 16:46746796-46746818 CGGTGCAGACAGCGGGGGCTAGG + Intronic
1137397332 16:48125397-48125419 GTGTGCAGAGCCCTTGGGCACGG + Intronic
1138211375 16:55166057-55166079 CTATGCAGACAGCTGGGGGAAGG - Intergenic
1138235585 16:55379810-55379832 CCCTCCAGACAGCTTGGGCGGGG + Intergenic
1138555999 16:57771547-57771569 CTGTGCTCACAACCTGGGCAGGG + Exonic
1139311517 16:66031979-66032001 CTGTGCAGAGAGCTGTGGCTGGG - Intergenic
1141127942 16:81414501-81414523 CTGAGCTGACAGCTCAGGCAGGG + Intergenic
1141268894 16:82521360-82521382 CGGGGCTGACAGCTGGGGCATGG - Intergenic
1142035092 16:87857700-87857722 CTGAGCAGACAGGTGGGGCCAGG - Intronic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1145761322 17:27426763-27426785 CTGGGGAGGCAGCCTGGGCAGGG - Intergenic
1146484076 17:33229338-33229360 CTGTGCTGAGAGCTGGGGAAGGG + Intronic
1147608864 17:41789696-41789718 CTGTGCAGACAGCTGAGTCTAGG - Intergenic
1148093029 17:45034105-45034127 CTCTGCAGAAAGTTTGGCCAGGG - Intronic
1149494014 17:57105715-57105737 CTCTGCAGGCAGCTTGCTCACGG - Exonic
1150851020 17:68703816-68703838 CAGTCAAGACAGCTTGTGCAGGG + Intergenic
1152591792 17:81217183-81217205 GTGGGCACACAGCTGGGGCAAGG + Intronic
1152717635 17:81907553-81907575 GTATGCAGACAGTTTTGGCAAGG - Exonic
1153107721 18:1547234-1547256 CTGGGGAGACAGGTTGGGAAAGG - Intergenic
1155777545 18:29785936-29785958 CTGTGCATGCAGATTGGGTATGG + Intergenic
1160717701 19:583858-583880 CTGGGCGGGCTGCTTGGGCAAGG + Intergenic
1160898984 19:1417316-1417338 GTCTGCAGACAGCATGGGCGAGG + Intronic
1161320094 19:3637130-3637152 CTGTGCAGCCAGCGGGGCCACGG + Intronic
1162804553 19:13130366-13130388 CAGTGCAGAGAGGCTGGGCACGG - Intronic
1163268128 19:16233680-16233702 CAATGCAGCCAGCTTGGGAAAGG + Intronic
1163389337 19:17020893-17020915 CTGGGCAGATAGCTTGTCCAAGG - Intronic
1163764060 19:19152762-19152784 TTGCCCAGACCGCTTGGGCAGGG - Intronic
1167380814 19:49136943-49136965 CTGTGGAGTCAGCTCCGGCAGGG - Intronic
927111959 2:19869756-19869778 CTGTGAAGACAGCCTGTGCCAGG - Intergenic
927576836 2:24207654-24207676 CAGTGCAGGGAGCTGGGGCAGGG + Intronic
929668712 2:43852928-43852950 CTTTCCAGCAAGCTTGGGCAGGG - Intronic
930858480 2:56044385-56044407 CTGGACAGACAGCTGGGTCAGGG + Intergenic
931934841 2:67185709-67185731 CTGTGGACAGAGATTGGGCATGG - Intergenic
932615374 2:73228110-73228132 CTGTGCAGAGACCCTGGGTAGGG + Exonic
935639862 2:105280471-105280493 CTCTGCATACAGTTTGAGCAAGG + Exonic
938323633 2:130382486-130382508 CTGTGCTGGCTGCTTGAGCATGG + Intergenic
940184994 2:150974321-150974343 TTGTTAAGACAGCTTGAGCAGGG - Intergenic
943848802 2:192689082-192689104 CAGAGAAGACAGCTTGTGCAGGG - Intergenic
944160323 2:196652768-196652790 CTTTGCAGAGAGCTTCTGCATGG + Intronic
946614715 2:221497114-221497136 CTGTGGAGGCAGTTTGGGGAAGG + Intronic
948928980 2:241118775-241118797 CAGGGCAGACAGCCTGGCCAAGG + Intronic
949003290 2:241630125-241630147 CAGTGCACACAGATTGGGCGAGG - Intronic
1169066081 20:2694634-2694656 CTCTGCTGACAGCTGGGACAGGG + Intronic
1169343546 20:4813366-4813388 CTGTGCAGACAGCTTGGGCAGGG - Intronic
1170075831 20:12417735-12417757 CAGTGCAGACAGCAGGGGCTGGG - Intergenic
1171463112 20:25309809-25309831 TTGTGCAGTCAGCAGGGGCAGGG - Intronic
1171858278 20:30370415-30370437 CTGTGAAGACAACTGGGGTAAGG + Intergenic
1173664291 20:44753913-44753935 CTGTGCAGACACCAGGGGAAGGG + Intronic
1174375123 20:50121501-50121523 CTGTGCAGAGAGCTCTGGCATGG - Intronic
1174378300 20:50140573-50140595 CCGTGCAGAGATCTTGGGGAGGG - Intronic
1175439169 20:58978827-58978849 CTGAGCAGAGAGCTTGCACATGG - Intergenic
1175507391 20:59495591-59495613 CTGTGAGGACATCATGGGCAGGG - Intergenic
1175767880 20:61603622-61603644 CTGGGCAGACGGGGTGGGCATGG - Intronic
1175901626 20:62362103-62362125 CTGAGTAGACAGCTTGGGGCTGG - Intronic
1177848187 21:26316267-26316289 AGTTGTAGACAGCTTGGGCAAGG + Intergenic
1178200108 21:30393923-30393945 ATGCTCAGACATCTTGGGCAGGG + Intronic
1178868985 21:36355657-36355679 CTGTTCAAACAGGCTGGGCATGG + Intronic
1179064648 21:38013741-38013763 CTCTGCACACAGCTGGGGCATGG - Intronic
1179931832 21:44575767-44575789 CTGTGCAGACATCACTGGCATGG + Intronic
1180082601 21:45493623-45493645 CTGTGGAGACAGCCTGGGGAGGG + Intronic
1180713223 22:17854205-17854227 CTGTTGACACAGCTTGGGGAGGG + Intronic
1180946265 22:19695424-19695446 CAGTGCAGCCACCTTGGGCCAGG + Intergenic
1183217427 22:36489981-36490003 CTGTGCCCACAGCTTAGGAAGGG + Exonic
1183773578 22:39947657-39947679 GGGTGGAGACAGCTTGGGAAAGG + Intronic
1183962143 22:41417995-41418017 CTGTCCTGCCACCTTGGGCAAGG - Intergenic
1184486544 22:44783317-44783339 CTGTGTGGACAGCTCGGGGATGG - Intronic
950421206 3:12900968-12900990 TTGTGTAGACAGCCTGGGTAGGG - Intronic
950454874 3:13086699-13086721 CTGTGCAGAGAGCTGAGGGAGGG - Intergenic
951620990 3:24602346-24602368 CTGGGCAGATAGAGTGGGCATGG - Intergenic
952768657 3:36977160-36977182 CTGTGCAGAGACCCTGGGTAGGG - Intergenic
953561120 3:43994876-43994898 CTGTGCAGAAAGCCGGGGAAGGG + Intergenic
953974267 3:47370749-47370771 TTGTGCAGGCCGCTTAGGCAAGG - Intergenic
954365624 3:50144630-50144652 CTGTGGGGACAGCATGGGTAGGG + Intergenic
959379069 3:105619872-105619894 CTCAGCAGACACTTTGGGCAGGG + Intergenic
959947846 3:112145897-112145919 AAGAGAAGACAGCTTGGGCAGGG - Intronic
961809812 3:129515254-129515276 CTGTGCAGGTGTCTTGGGCACGG + Intronic
964655990 3:159066696-159066718 CGGTGTTGACAGTTTGGGCAGGG + Intronic
966650960 3:182300526-182300548 GTGAGAAGACAGCTAGGGCAGGG + Intergenic
966807622 3:183819190-183819212 CTGGGCAGGCTGCGTGGGCAGGG + Intronic
967564432 3:190957445-190957467 CTGTGCCTACAGCTTGAGAAAGG + Intergenic
969369211 4:6720576-6720598 GTGTGCAGACAGAGTGGGGACGG + Intergenic
969522926 4:7689254-7689276 CTGTGCTGACAGCCTGGGAGGGG - Intronic
971836024 4:31763517-31763539 ATATTCAGAAAGCTTGGGCATGG + Intergenic
974676488 4:65096425-65096447 CAGATAAGACAGCTTGGGCAAGG + Intergenic
975612685 4:76217225-76217247 AGGGGCAGACAGCTTGGGAAGGG + Intronic
979275460 4:118810277-118810299 CTGTGCAGACTGAAAGGGCAGGG + Intronic
979692882 4:123579209-123579231 TGGAGCAGACAGCTTAGGCAAGG + Intergenic
983183978 4:164679897-164679919 CTGTGCAGTGAGCCTGGGAAAGG - Intergenic
985672892 5:1215145-1215167 CACTGCAGGCAGCTGGGGCAGGG + Intronic
985931235 5:3059276-3059298 CTGTCTAGACCGCCTGGGCACGG + Intergenic
986105291 5:4653981-4654003 CTGTGGAAGCAGCTTGGGGATGG - Intergenic
987597675 5:20021698-20021720 CTGTACAGAAAGCATGGCCAGGG - Intronic
991638816 5:68733324-68733346 CTGGGCAGGCAGGTGGGGCAAGG - Intergenic
992508009 5:77406960-77406982 CTGTGCAGCCAGCTTGAGAGGGG - Intronic
993431267 5:87834578-87834600 CAGTGCAGTGTGCTTGGGCAGGG + Intergenic
993583653 5:89696049-89696071 CTTGGCAGACAGCTAGGTCATGG + Intergenic
995851256 5:116548273-116548295 CTGTTCAGCCACCTTGGGCATGG - Intronic
995938716 5:117551453-117551475 CTGTGCAGTCAGCTGTGGCCGGG + Intergenic
998402595 5:141855776-141855798 CTGGGCAGGGAGCTGGGGCAAGG - Intronic
998474197 5:142407064-142407086 CTATGCAGTGGGCTTGGGCAGGG + Intergenic
999734803 5:154505274-154505296 CTGTGCTGAATGCTTGGGAATGG + Intergenic
1000014867 5:157267256-157267278 CTGTGCCCTCAGCATGGGCAGGG + Intronic
1000273369 5:159709191-159709213 CTGTGAATACAGCATGGGCAAGG + Intergenic
1000462440 5:161539284-161539306 CTGAGCAGAAAGCTTGGCCTTGG - Intronic
1000729897 5:164820943-164820965 ATGTGCAAATAGCTTGGTCAAGG - Intergenic
1001924809 5:175628304-175628326 CTGAGCATACAGCTTTGGGAGGG - Intergenic
1002000403 5:176193698-176193720 CTGTGCTGACAGCGGGTGCAGGG - Intergenic
1002598880 5:180342501-180342523 CTGTGGGGATAGCTTGGGCCTGG - Intronic
1003171464 6:3724742-3724764 CTGTGCAGTCATCTTGGTCATGG - Intronic
1003392421 6:5725306-5725328 CTTTGGAGGCAGGTTGGGCAAGG + Intronic
1004609793 6:17229267-17229289 CTCTGCTGACACTTTGGGCAGGG - Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1007099588 6:39236665-39236687 CTCTACAGGCACCTTGGGCAGGG + Intergenic
1007468691 6:42073962-42073984 CTGTGCTAACAGATTGGGTATGG + Intronic
1011085792 6:83538883-83538905 CTGTGAAGACAGTTTTGACATGG - Intergenic
1015669429 6:135672076-135672098 ATGTGCAGACAGCTGGGCCTGGG + Intergenic
1016175657 6:141075170-141075192 CTGTGCAGACAACTTGGTGCAGG - Intergenic
1019558451 7:1644138-1644160 CTGTCCACACAGGCTGGGCATGG + Intergenic
1020087931 7:5321431-5321453 CTTTGCAGACATCTGGGGCCAGG - Intronic
1021036899 7:15810278-15810300 TTCTGCAGCCAGCTTGGGCTTGG + Intergenic
1022524191 7:31027022-31027044 CCCTGCAGAGAGCCTGGGCAGGG + Intergenic
1022604231 7:31792619-31792641 CTATCCAGGCAGCTTTGGCATGG + Intronic
1022913587 7:34924172-34924194 GTCAGCAGACAGCTTGTGCAGGG - Intergenic
1025022263 7:55489014-55489036 CTGAGCAGACAGCTGCAGCAGGG + Intronic
1025190810 7:56894284-56894306 CAGTGCAGACCGCTTTGGAAAGG - Intergenic
1025206367 7:56995671-56995693 CTTTGCAGACATCTGGGGCCAGG + Intergenic
1025665568 7:63581256-63581278 CTTTGCAGACATCTGGGGCCAGG - Intergenic
1025681133 7:63682640-63682662 CAGTGCAGACCGCTTTGGAAAGG + Intergenic
1027940511 7:84672997-84673019 CAGTGCTCACAGCTTGGGCTGGG + Intergenic
1029574069 7:101391359-101391381 CTGTGAATTCATCTTGGGCAAGG + Intronic
1029585147 7:101465906-101465928 GTGTGCAGCTGGCTTGGGCAAGG + Intronic
1029628263 7:101734039-101734061 CTGTGCTGAGAGCCAGGGCAGGG - Intergenic
1034741593 7:153478905-153478927 CCTGGCAGACTGCTTGGGCAGGG - Intergenic
1034998230 7:155591773-155591795 CTATGGAGAGAGCTTGGGGAAGG - Intergenic
1036579306 8:10057802-10057824 CTGTACAGAAAGCATGGCCAGGG - Intronic
1037992423 8:23330462-23330484 GTGGGAAGACAGCTTGGGAAGGG - Intronic
1039914333 8:41848772-41848794 CTGTGCAGACAGCCTGGTATTGG + Intronic
1040276671 8:46017388-46017410 ATGTTCAGGCAGCTTGGGAAAGG - Intergenic
1040434561 8:47377697-47377719 CTGTGTAGACAGAGTGGTCAAGG + Intronic
1041788485 8:61663262-61663284 CTGTGCACAAAGCTTTGGAATGG - Intronic
1042361939 8:67893625-67893647 CAGGGAAGAGAGCTTGGGCAGGG + Intergenic
1046033289 8:108808930-108808952 CTGAGAAGACAGCTTGAGCCTGG + Intergenic
1047518876 8:125579082-125579104 TTCTGCAGACAGCTTAGGAATGG + Intergenic
1047571075 8:126099207-126099229 TAATGCAGACAGCTTGGACAAGG + Intergenic
1047653762 8:126952964-126952986 CTGTGAAGACGCCTTGAGCAGGG - Intergenic
1047762298 8:127963190-127963212 GTGTGAAGTCAGCCTGGGCAGGG - Intergenic
1048300057 8:133244938-133244960 CTGTGCAGCCAGCCTGGAAATGG + Intronic
1048406629 8:134129099-134129121 CAGTGCAGTCAGCCTTGGCAGGG + Intergenic
1048406702 8:134129893-134129915 CCGTGCAGTCAGCCTTGGCAGGG + Intergenic
1048947690 8:139465109-139465131 ATGTGCTGACAGATTGTGCATGG - Intergenic
1049498432 8:142947618-142947640 CCGTGCAGACAGGGTGGCCAGGG - Intergenic
1050132518 9:2427431-2427453 CAGAGAAGACAGCTTGGGGAAGG + Intergenic
1052763603 9:32618056-32618078 TTGTGGAGACAGCTGGGGGAGGG + Intergenic
1054905095 9:70407715-70407737 TTCTGCAGAGAGCTTGGGCTGGG + Intronic
1056733370 9:89184386-89184408 CTATTCAGACAGCTTGTGTAAGG + Intergenic
1058869557 9:109190542-109190564 CTGGGCTGACAGCTTGGAGATGG + Intronic
1058931400 9:109722893-109722915 CAGAGCAGACGGCTTGTGCAAGG - Intronic
1059923817 9:119186500-119186522 CTGCTCTGCCAGCTTGGGCATGG - Intronic
1060879052 9:127104922-127104944 CTGTTCAGAGAGCTTGGGGCAGG - Intronic
1061015319 9:127977986-127978008 CTGTGCTCACAGCTAGGGCCTGG - Intronic
1061897268 9:133654992-133655014 CCGTGAAGCCAGATTGGGCAGGG - Intronic
1062149751 9:135011624-135011646 TTGTGCAGACAGTTTGGTCTTGG - Intergenic
1187525214 X:20048011-20048033 CTGTAAAGACACCTTGGCCAAGG + Intronic
1189745432 X:44163507-44163529 CTGTGCACACAGGTTTGCCATGG - Intronic
1193551098 X:82893599-82893621 CTGTGCAGAGATCTGGTGCAGGG + Intergenic
1194172256 X:90601779-90601801 CTGTGCAGACATCTTGGTGCAGG + Intergenic
1194445738 X:93985708-93985730 CTGTTGAGGCAGCTTGGGTAAGG - Intergenic
1200049990 X:153423809-153423831 CTGTGCAGACAGTCTTTGCAAGG + Intergenic
1200384214 X:155873456-155873478 CTGTGAAGTCAGCTTGCGCTTGG + Intergenic
1200518487 Y:4179515-4179537 CTGTGCAGACATCTTGGTGCAGG + Intergenic