ID: 1169344224

View in Genome Browser
Species Human (GRCh38)
Location 20:4817638-4817660
Sequence TCTCCAGAGGAGGCCTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 363}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169344224_1169344234 26 Left 1169344224 20:4817638-4817660 CCTCTCCAGGCCTCCTCTGGAGA 0: 1
1: 0
2: 3
3: 38
4: 363
Right 1169344234 20:4817687-4817709 CACTGATATACAAGACAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 136
1169344224_1169344228 -10 Left 1169344224 20:4817638-4817660 CCTCTCCAGGCCTCCTCTGGAGA 0: 1
1: 0
2: 3
3: 38
4: 363
Right 1169344228 20:4817651-4817673 CCTCTGGAGACACACCATGCCGG 0: 1
1: 0
2: 0
3: 13
4: 216
1169344224_1169344229 0 Left 1169344224 20:4817638-4817660 CCTCTCCAGGCCTCCTCTGGAGA 0: 1
1: 0
2: 3
3: 38
4: 363
Right 1169344229 20:4817661-4817683 CACACCATGCCGGAGTCCTGAGG 0: 1
1: 0
2: 0
3: 11
4: 123
1169344224_1169344233 22 Left 1169344224 20:4817638-4817660 CCTCTCCAGGCCTCCTCTGGAGA 0: 1
1: 0
2: 3
3: 38
4: 363
Right 1169344233 20:4817683-4817705 GTGACACTGATATACAAGACAGG 0: 1
1: 0
2: 0
3: 2
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169344224 Original CRISPR TCTCCAGAGGAGGCCTGGAG AGG (reversed) Intronic
900373874 1:2344506-2344528 GCTGCTGAGGAGGCCAGGAGCGG + Intronic
900419707 1:2550622-2550644 TCCCCAGAGGGCGGCTGGAGGGG - Intergenic
900565580 1:3330376-3330398 CCACCAGAGAAGGCCTTGAGCGG - Intronic
900701438 1:4051016-4051038 ATTCCAGAGGAGGCCAGGCGCGG - Intergenic
900738045 1:4311652-4311674 CCTGCAGAGGAGGTCGGGAGGGG - Intergenic
901204159 1:7484287-7484309 TCTCCCCAGGAGGCCTGGAAAGG + Intronic
901643116 1:10703051-10703073 TGCAGAGAGGAGGCCTGGAGGGG + Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902222616 1:14976604-14976626 GCCCCAGAGGAGGCCGGGAGGGG + Intronic
902404584 1:16175697-16175719 TCTCCAGAGCAGGAACGGAGGGG + Intergenic
902415145 1:16234107-16234129 TACACAGAGGAGGCCTGGTGCGG + Intronic
902434270 1:16387329-16387351 TCCTCAGAGGAGACCTGGATGGG + Intronic
902723906 1:18322822-18322844 TCTGGAAAAGAGGCCTGGAGAGG + Intronic
903362676 1:22786667-22786689 TCTCAAGAGACAGCCTGGAGTGG + Intronic
904292519 1:29497224-29497246 ACACCAAAGTAGGCCTGGAGAGG - Intergenic
904483709 1:30810183-30810205 GCTCCACAGGGGACCTGGAGTGG - Intergenic
904659762 1:32075621-32075643 TGGCCAGAGGAGGGCTGGAGAGG - Exonic
904841763 1:33376638-33376660 TCTACAGAGAAGGCCGGGTGCGG + Intronic
905095485 1:35466550-35466572 TCTCCTCAGGAGTCCTGCAGAGG + Intronic
905455264 1:38084072-38084094 GCTCCAGAGGACACCTGGTGGGG + Intergenic
905861926 1:41357748-41357770 TGACCAGAGGAGGCCTCCAGGGG - Intergenic
905907028 1:41626075-41626097 TCTTCAGAAGGGGCCTGAAGTGG - Intronic
907426816 1:54384997-54385019 TCTCCAGAGTAGGCCTGGGCAGG + Intronic
908862788 1:68508342-68508364 TCTTCATAGGAGGCCGGGCGCGG - Intergenic
910213068 1:84813805-84813827 TTCCCAGAGGAGGCCTGGGTGGG + Exonic
911834617 1:102600881-102600903 TATCCAGAGGAAGGCTGCAGAGG + Intergenic
912907994 1:113727850-113727872 CCTCCTGAGTAGGCTTGGAGTGG - Intronic
913225453 1:116694650-116694672 TTTCCAGAGGAAGCCTAGGGAGG - Intronic
913483139 1:119308807-119308829 TCTCAAAAGGAGACTTGGAGAGG + Intergenic
913489771 1:119368158-119368180 TCTCCAGAAGAGTTCTGTAGGGG - Intergenic
915087581 1:153398590-153398612 TCTCCAGAGGAAGTGGGGAGTGG - Intergenic
915233072 1:154460282-154460304 TGTCCAGAGCTGGCCTGGATGGG - Intronic
915507298 1:156366072-156366094 TTCTCAGAGGAGGCCTGGAGTGG + Intronic
915551481 1:156637936-156637958 TCCCCATAGGAGGCTGGGAGAGG + Intergenic
916827056 1:168452558-168452580 TGTCCAGAGCAAGCCTGGGGTGG + Intergenic
919844691 1:201634480-201634502 TCTCCCAGGGAGGCCAGGAGAGG + Intronic
920179824 1:204125774-204125796 TGCTCTGAGGAGGCCTGGAGGGG + Intronic
920302322 1:204996708-204996730 TGTCCAGCAGAGGCCTAGAGTGG - Intronic
921080119 1:211732373-211732395 TCTGCAGAGCAGGGCTGCAGGGG + Intergenic
921312833 1:213861595-213861617 TCTGCAGAGGTGGCTTGGAATGG - Intergenic
922022944 1:221722471-221722493 TCTGAAGAGCAGGCCTGGTGTGG + Intronic
923136309 1:231123199-231123221 TTCCCAGTGAAGGCCTGGAGGGG - Intergenic
924502741 1:244652748-244652770 TCTCCCGGGGAGGCCTGGTCTGG + Intergenic
924565728 1:245196550-245196572 CCTCCAGAGTAGACCTGGGGTGG + Intronic
1062901357 10:1149073-1149095 TCTCCAGAAGGAGGCTGGAGAGG - Intergenic
1064144799 10:12819162-12819184 TTTCCCGAGGAGGCTGGGAGAGG + Intronic
1064605236 10:17032222-17032244 TCTCCAGAAGGGGCGTGGAGGGG + Intronic
1064970631 10:21062975-21062997 GCTACAGAGGAGACCTGGAGGGG + Intronic
1065170044 10:23018195-23018217 TCTCCAGAACAGGCCTGGGTGGG - Intronic
1065901124 10:30209081-30209103 TCAACAGAGGAAGCATGGAGGGG - Intergenic
1067575611 10:47406551-47406573 TTTACAGAGGAGGGATGGAGAGG - Intergenic
1068776231 10:60871477-60871499 TCTCCAGCAGTGGCCTGAAGAGG - Exonic
1069589069 10:69630710-69630732 ACTCAAGGGGAGGCGTGGAGGGG + Intronic
1070159947 10:73860322-73860344 TCTCCAGAGGAGCCAGGCAGGGG + Intronic
1070541754 10:77420426-77420448 TCTACTGAAGAGGTCTGGAGAGG - Intronic
1070704095 10:78624975-78624997 TCTGCAGAGGAGGCATGGCCAGG + Intergenic
1071122314 10:82293371-82293393 TCTCTAGAGCAAGCCTAGAGAGG + Intronic
1071489512 10:86126786-86126808 TCCCCTGAGAAGGCCTGGTGTGG - Intronic
1071528591 10:86372650-86372672 TCTACAGAGTGGGCCTGGGGTGG + Intergenic
1072202720 10:93175730-93175752 TCTCCTGATGAGGCCAGGACAGG + Intergenic
1072694221 10:97590996-97591018 ACTCCAGAGGACTGCTGGAGAGG - Intronic
1074369359 10:112887067-112887089 TATCCACAGGAGGCCTGATGGGG - Intergenic
1075428636 10:122362634-122362656 TCTCCAGTGGCAGCTTGGAGTGG + Intergenic
1076795295 10:132795245-132795267 TCTCCAGGGCAGGGCTGGGGAGG + Intergenic
1077307462 11:1874526-1874548 GCTCCAGGGGAGGCCAGGTGGGG + Intronic
1077860169 11:6170973-6170995 AATCCAGAGGAAGCCTAGAGGGG + Intergenic
1077938884 11:6818623-6818645 TCAGCAGAGGAGACCTGGAGTGG - Intergenic
1078742046 11:14075829-14075851 TCTCCAGAGAAGCCCAGCAGGGG + Intronic
1079101556 11:17545041-17545063 TATCCAGAGAAGGCCGGGCGCGG - Intergenic
1079390989 11:20022017-20022039 TCTCCAGTGGAAGCAGGGAGCGG - Intronic
1081613233 11:44575954-44575976 TCTCCAGTGCAGGTCTGGTGCGG + Intronic
1081745277 11:45468498-45468520 GCTCCAGAGGAGGACTGGCCTGG + Intergenic
1082795047 11:57372679-57372701 TCTGAAGATCAGGCCTGGAGTGG + Intergenic
1084599569 11:70136855-70136877 TTTCCAGAGGAGGCCAAGAATGG + Intronic
1085260921 11:75204226-75204248 TCTGCAGAGGAGCCCTGGGTGGG - Intronic
1085526321 11:77166292-77166314 GCTCCAGGAGGGGCCTGGAGGGG + Intronic
1086577410 11:88355695-88355717 TTTCCAGAGGAGAGGTGGAGAGG - Intergenic
1086942155 11:92809515-92809537 TCTCCAGAGTAGATCTTGAGAGG + Intronic
1087429670 11:98036713-98036735 TCTACAGAGAAAGTCTGGAGGGG + Intergenic
1088539880 11:110902659-110902681 TCCCCAGAGGCTGCCTGAAGAGG + Intergenic
1088903742 11:114138264-114138286 TTTGCAGTGGAGGCCAGGAGAGG + Intronic
1089660384 11:119981703-119981725 CCACCAAAGGAGGCCTGGTGGGG - Intergenic
1090424131 11:126595253-126595275 TCTCCAGAGCCAGGCTGGAGAGG - Intronic
1090825380 11:130381489-130381511 TCTCCGGTGGAGCCCAGGAGGGG + Intergenic
1091675249 12:2484526-2484548 CCTCCAGCTGTGGCCTGGAGGGG + Intronic
1091882333 12:3990062-3990084 TCTCTAGCTGAGCCCTGGAGAGG - Intergenic
1092783572 12:12008669-12008691 TCTACAGAGAGGGCATGGAGAGG + Intergenic
1095699263 12:45174598-45174620 TCTCCTGAAGATGCCTGGAAAGG - Intergenic
1096179833 12:49544604-49544626 TGGCCACAGGAGGCCTGGATGGG - Intronic
1096545821 12:52339553-52339575 ACAACAGAGGAGGCCTGGGGAGG - Intergenic
1097831515 12:64229427-64229449 TCTCCACAGGACGGCTTGAGTGG + Intergenic
1100703853 12:97178937-97178959 TCTGCAGAGTAGTCCTGGGGAGG + Intergenic
1102730254 12:115102805-115102827 TCTGCAGAAGAGGCCAGAAGAGG + Intergenic
1103322460 12:120100010-120100032 TGTCCTGAGGAGCCCTGGGGTGG - Intronic
1103457724 12:121079741-121079763 TTTGCAGAGGAGACCTGGGGAGG - Intergenic
1103520902 12:121536704-121536726 TGTTCAGCTGAGGCCTGGAGGGG - Intronic
1103869486 12:124081117-124081139 CCTCCAGAGAAGGCCCTGAGTGG + Intronic
1103927559 12:124432365-124432387 TCTGCAGAGGAGGCCAGGTCTGG - Intronic
1104680133 12:130744581-130744603 TTTCCTGAGGTGGGCTGGAGAGG - Intergenic
1105210130 13:18252690-18252712 GCCCCAAGGGAGGCCTGGAGGGG + Intergenic
1105985592 13:25563117-25563139 TTTCAAGAGGAGGCCAGGTGCGG + Intronic
1107058542 13:36131362-36131384 TCTCCAGAGGAGGGCGGCGGCGG + Intergenic
1107902876 13:45035244-45035266 TCTCCATTGGAGGCCGGGGGCGG - Intronic
1108506632 13:51118355-51118377 CCTCCAGAAGACACCTGGAGAGG + Intergenic
1110357868 13:74589251-74589273 ACACCAGAGGAGCCCAGGAGTGG - Intergenic
1110794691 13:79622826-79622848 ACACCAGAGGACACCTGGAGTGG + Intergenic
1110939496 13:81331106-81331128 TGTTCAGAGGAGACCTGTAGTGG - Intergenic
1112195918 13:97226172-97226194 TCAGCAGAGGAGGCCGGGACTGG - Intronic
1112223361 13:97513803-97513825 TCTGCACAGGAAGCATGGAGTGG + Intergenic
1113055329 13:106260834-106260856 GCTGCAGAAGAGGCCTGGGGTGG - Intergenic
1116254126 14:42528160-42528182 TCTTCAGCGGATGCCTGGAAAGG - Intergenic
1116410196 14:44612053-44612075 TCTACAGAGGAGACCAGGAATGG + Intergenic
1116859226 14:49980448-49980470 TTTCCAGAGGAGTCCTGGGAAGG - Intergenic
1116909147 14:50439694-50439716 TTCCCAAAGGAGGCCAGGAGTGG + Intronic
1117486911 14:56207023-56207045 TCTGCAGAGAAATCCTGGAGAGG + Intronic
1117714246 14:58564152-58564174 GCTCCAGAGGAACCCTGCAGAGG + Intergenic
1118981625 14:70721666-70721688 GCTCCAGAAGAGGCCCAGAGAGG + Intergenic
1121283297 14:92714841-92714863 GGGCCACAGGAGGCCTGGAGGGG - Intronic
1122015489 14:98791800-98791822 TACACAGAGGAGGGCTGGAGGGG + Intergenic
1122070072 14:99200499-99200521 CCCCCAGAGGAGGCCTGTCGTGG - Intronic
1122579818 14:102764547-102764569 ACTCAGGAGGAAGCCTGGAGTGG - Intergenic
1123994084 15:25706273-25706295 TCACCAGAGAAAGCCTGCAGAGG + Intronic
1124005952 15:25795751-25795773 TCTTCAGCAGAGGTCTGGAGGGG - Intronic
1124235926 15:27989434-27989456 TCTCCTGAGGAGGAATGGAATGG - Intronic
1124412983 15:29451852-29451874 TCTGCACAGAAGGCCTGGGGAGG - Intronic
1124413205 15:29453469-29453491 TCTGCACAGAAGGCCTGGGGAGG + Intronic
1124685454 15:31778050-31778072 TCTCCAGAAGAGGCCTGGGCTGG + Intronic
1125010305 15:34865143-34865165 TCCCCAGAAGATGGCTGGAGAGG + Intronic
1127275451 15:57439370-57439392 TCGGCTGGGGAGGCCTGGAGTGG - Exonic
1127621897 15:60741925-60741947 TGTCCAGAGGAGGCTTGGCAGGG - Intronic
1128072840 15:64808035-64808057 ATTCCTGAGGAGGCCTGGGGCGG - Intergenic
1128324928 15:66718216-66718238 ATTCCAGAGGGGGCCTGGTGTGG + Intronic
1129061582 15:72864559-72864581 TCTCCAGTGGATCCCTGGAGGGG - Intergenic
1129178227 15:73855274-73855296 TCTCCAGGAGAGCCCTGAAGGGG + Intergenic
1130783113 15:87066070-87066092 TCTACAGAGATGGCCTGGACTGG + Intergenic
1130927995 15:88399341-88399363 CCTGCAGAGGAGGCCTAGAGAGG + Intergenic
1131009250 15:89003709-89003731 TCTCCACAGGTGGCCAGGCGCGG - Intergenic
1131437133 15:92432025-92432047 TCTCCCGTGGATGCCTGGAGAGG - Intronic
1132481559 16:168816-168838 TGGCCAGTGGAGCCCTGGAGTGG - Intergenic
1133770615 16:8865516-8865538 TTTGCAGAGCAGGCTTGGAGAGG - Intronic
1134911088 16:18026963-18026985 TAACCAGAGTAGGCCGGGAGCGG - Intergenic
1136861501 16:33707076-33707098 GCTCCAGGGGAGGCCAGGTGGGG - Intergenic
1138563549 16:57816351-57816373 CCTCAAGAGGAAGCCAGGAGGGG - Intronic
1139296597 16:65906850-65906872 TCTACAGAGGAGGCACAGAGAGG + Intergenic
1139642107 16:68299190-68299212 GCTCCAGAGGAGCCCTGGGATGG - Exonic
1141988579 16:87595992-87596014 TCTCCAGGGGATCCCTGGAGAGG + Intergenic
1203123001 16_KI270728v1_random:1555267-1555289 GCTCCAGGGGAGGCCAGGTGGGG - Intergenic
1142614007 17:1124707-1124729 TGAACAGAGGAGGGCTGGAGCGG + Intronic
1143265078 17:5630596-5630618 TCCCCTGGGGAGCCCTGGAGTGG + Intergenic
1144670078 17:17127940-17127962 TCTCCAGGGGAGGACTCTAGGGG - Intronic
1146374113 17:32282910-32282932 TCTCCACAGAAGGCCGGGCGCGG - Intronic
1146489678 17:33271365-33271387 GCTCCAGAGGAGGTCAGGACAGG - Intronic
1147266577 17:39238004-39238026 TCTCCAGAGGAGCCCGGGAATGG - Intergenic
1147627698 17:41910518-41910540 CCTCCAGAGGAGGCCAAGAGTGG - Intronic
1147925132 17:43941345-43941367 TCCCAAGAGCAGGCCTGGAAGGG + Intronic
1148572438 17:48680925-48680947 TTACCAGAGGAAGCCTAGAGTGG + Intergenic
1149324394 17:55515341-55515363 TCTCCAGAGGCTGCCAGGTGAGG - Intergenic
1150305723 17:64083750-64083772 TGTCCAGCTGAGGCCTGGAATGG + Intronic
1150473375 17:65456384-65456406 TCTCCAGAATAAACCTGGAGTGG - Intergenic
1151236068 17:72720507-72720529 TCTCCTGGGGAGGCAGGGAGTGG + Intronic
1151555861 17:74846420-74846442 TCTGCAGAGGAGGGTGGGAGGGG - Intronic
1151678176 17:75610513-75610535 GGCCCAGGGGAGGCCTGGAGGGG - Intergenic
1151956252 17:77381566-77381588 GCTCCAAACCAGGCCTGGAGGGG + Intronic
1152316982 17:79586739-79586761 TCTCCAGAGAAACCCGGGAGAGG - Intergenic
1152475638 17:80516308-80516330 TCCTCAGAGGAGGCCTGGCTGGG - Intergenic
1152610781 17:81314148-81314170 CCCCCACAGGAGGCCTGGATGGG - Intronic
1153708670 18:7774625-7774647 TCTCCATAGGAGGCCTTGGTGGG + Intronic
1156366913 18:36438028-36438050 CCTCCAGAGGCTGCCTGCAGGGG + Intronic
1156654736 18:39271847-39271869 TCCCCAGAGGAGACCTGGAGCGG - Intergenic
1157556407 18:48615749-48615771 ACTGCAGAGGAAGCCTGGACAGG + Intronic
1158079939 18:53577951-53577973 TCTCCAGAGTAGGTCTGCAGTGG + Intergenic
1158301523 18:56058052-56058074 TCCCCAGAGGAGGCCGGGCGCGG - Intergenic
1159040455 18:63319568-63319590 TCTCCTGGGGAGGCGTGAAGCGG - Exonic
1159556933 18:69955575-69955597 TTTCCACAGGAGGCCGGGTGCGG + Intronic
1159916677 18:74194192-74194214 TGGCCTGAGGAGTCCTGGAGAGG + Intergenic
1160037942 18:75318819-75318841 TCTCCTAAGGAGACCTGGACAGG - Intergenic
1160559980 18:79750067-79750089 TCTGCAGATGAGGCATGGAGGGG + Intronic
1160562264 18:79766028-79766050 TTTCCCAAGGAGGCCTGGAAAGG + Intergenic
1160816755 19:1039624-1039646 TCTGCAGAGGATGGCAGGAGGGG - Intergenic
1161067007 19:2243587-2243609 TTTCCAGGGCAGCCCTGGAGAGG + Intronic
1161088568 19:2346188-2346210 TCGGCAGAGGAGGCCTGGCCTGG - Intronic
1161184442 19:2907019-2907041 TCTCCAGAGGAGTCCAGGCGGGG + Intronic
1161249042 19:3270724-3270746 TTTAGAGTGGAGGCCTGGAGAGG + Intronic
1161281438 19:3447812-3447834 TTTCCAGGGGGTGCCTGGAGGGG + Intronic
1161349574 19:3784451-3784473 TCTGCAGAGGGGGCCGGGAGAGG + Exonic
1162385475 19:10358135-10358157 TCTCCTGAGGTGGGCAGGAGAGG + Exonic
1163328102 19:16618244-16618266 TGACCACAGGAGGCCTGGTGGGG + Intronic
1163689506 19:18730883-18730905 TGTCCAGAGGGAGCTTGGAGAGG + Intronic
1164815672 19:31200556-31200578 TGTCCAGTGGAGGAATGGAGGGG + Intergenic
1164821976 19:31257521-31257543 CCTCCAGAGGGGTCCTGGGGTGG - Intergenic
1165428046 19:35756395-35756417 TCTCCAGAAGAGGAGGGGAGAGG - Intronic
1165747831 19:38240802-38240824 ACCCCAGTGGACGCCTGGAGGGG + Intergenic
1165777301 19:38412410-38412432 TCTAGATAGGAGGCCAGGAGTGG - Intronic
1165815962 19:38642421-38642443 TTTCCAGAGCTGGGCTGGAGTGG - Intergenic
1165844992 19:38812519-38812541 TCTGGAGAAGAGGCCTGGTGAGG + Exonic
1166945897 19:46396091-46396113 CCCACAGAGGAGGTCTGGAGGGG - Intergenic
1167200384 19:48061259-48061281 TCTCGAAAGGAGGCCATGAGGGG + Intronic
1167472662 19:49684301-49684323 TCTCCCGGGGAGGCCTGCTGGGG - Intronic
1167698273 19:51027358-51027380 GCCCCAGAGGAGCCCTGGGGTGG - Intronic
926116724 2:10218122-10218144 CGGCCAGAGGTGGCCTGGAGTGG - Intergenic
926192425 2:10738841-10738863 TCTCCTGTGGAGGGCTGGACAGG - Intronic
926937773 2:18103545-18103567 TCACCAGATCTGGCCTGGAGAGG + Intronic
927940268 2:27099238-27099260 TCAGCAGAGGAAGCCTTGAGGGG + Exonic
928693449 2:33824441-33824463 TGTGCGGATGAGGCCTGGAGGGG + Intergenic
929072546 2:38048397-38048419 TCTCCAGAGGAGTCAGGGAATGG - Intronic
929314821 2:40464611-40464633 ACTACAGAGGAGGAATGGAGTGG + Intronic
929457216 2:42074502-42074524 CCTGCAGAGGAATCCTGGAGGGG + Intergenic
931183703 2:59929303-59929325 ACTTCAGAGGAGACCTGAAGTGG - Intergenic
932746111 2:74334914-74334936 TATCCTGAGGAGGCGGGGAGGGG + Intronic
933168169 2:79097155-79097177 TCTGCAGAGGAGGCATGGTCTGG + Intergenic
933901765 2:86855230-86855252 TTTCCAGAGGAGGCTCAGAGAGG - Intronic
935778783 2:106494033-106494055 TTTCCAGAGGAGGCTCAGAGAGG + Intergenic
935947714 2:108301299-108301321 TCCCCAAAGGAGGCCAGGCGCGG + Intronic
937268593 2:120632985-120633007 GCTGCAGAGAAGGCCTGGTGGGG + Intergenic
938382975 2:130847003-130847025 TCTCCAGAGGAGGCCTGAGCAGG + Intronic
938561597 2:132476949-132476971 TCCCCAGAGGCTGCCTGGAGAGG - Intronic
940241284 2:151565794-151565816 TCTACAGAGCTGACCTGGAGTGG - Exonic
942025615 2:171907829-171907851 TCTCCAGTGGAGGCCAGGCGTGG - Intronic
942618101 2:177815918-177815940 TCTACAGAGCAGGCCAGGTGTGG + Intronic
943048610 2:182888888-182888910 CCTGCAGAGGAGCCCTGCAGTGG + Intergenic
944132623 2:196363126-196363148 TGTCCAGAAGAGGCCTGGACAGG - Intronic
944531590 2:200673144-200673166 TTTACAGAGGTGGGCTGGAGGGG - Intronic
945033809 2:205687072-205687094 TCTCCAGACGAGGAGGGGAGGGG - Intronic
945280589 2:208031846-208031868 GCCCCAGAGGAGGCCTGTGGAGG - Intergenic
946291661 2:218750012-218750034 TATCCAGTGGAGAGCTGGAGTGG - Exonic
948217832 2:236244951-236244973 TCTACAGAGGAGGGCTGCAGTGG + Intronic
948552762 2:238785632-238785654 TCTCCAGTGAAGAGCTGGAGTGG - Intergenic
948710059 2:239819825-239819847 TCTCAAGATGAGGAGTGGAGGGG + Intergenic
949003423 2:241631169-241631191 TCTCCAGATGTGTCCTGGGGAGG - Intronic
949058874 2:241945089-241945111 TTTCCACAGGAGACTTGGAGAGG - Intergenic
1169344224 20:4817638-4817660 TCTCCAGAGGAGGCCTGGAGAGG - Intronic
1171080446 20:22177195-22177217 TAACCAGAAGAGACCTGGAGTGG + Intergenic
1171376089 20:24694958-24694980 TCTCCAAAGGAAGCCTGGCTGGG - Intergenic
1172189459 20:33053462-33053484 TCTCCATGTGAGGCCTGGTGCGG + Intergenic
1173448244 20:43139158-43139180 TCTCCAGCTGAGGCCTTTAGTGG - Intronic
1175248878 20:57597177-57597199 ACTGCAGGGGCGGCCTGGAGGGG - Intergenic
1175973985 20:62701277-62701299 TCTCCTCAGCAGGCCTGGAAAGG + Intergenic
1176160292 20:63644106-63644128 TCTCCAGAGGCAGCCAGGACGGG + Intronic
1176163626 20:63661515-63661537 TCCCCACAGGAGGCCAGGAGAGG - Intronic
1176430991 21:6575519-6575541 TCACCAGAGGAGGGCTGGACTGG + Intergenic
1176760907 21:10787794-10787816 TTTCCACAGTAGGCCTCGAGGGG - Intergenic
1177891175 21:26805692-26805714 TCTACACATTAGGCCTGGAGTGG + Intergenic
1178765547 21:35447405-35447427 CCTCAAGTGGTGGCCTGGAGTGG - Intronic
1179062948 21:37996477-37996499 TCTGAAAAGCAGGCCTGGAGAGG + Intronic
1179175453 21:39004985-39005007 GTTCAAGAGGAGGCCTGGCGTGG - Intergenic
1179465459 21:41568700-41568722 CCTCCAGACGAGGGCTGGACAGG + Intergenic
1179610525 21:42547401-42547423 ACTCCTGAGGAGGCCTGGCCAGG - Intronic
1179706385 21:43182981-43183003 TCACCAGAGGAGGGCTGGACTGG + Intergenic
1180635292 22:17258728-17258750 TGAGCAGAGGAGGCCAGGAGGGG + Intergenic
1180796521 22:18608473-18608495 TCCCCAGAAGGGGTCTGGAGAGG + Exonic
1180921306 22:19522930-19522952 TCTCCACAGGAGTCCTTGGGAGG + Intergenic
1181225202 22:21386798-21386820 TCCCCAGAAGGGGTCTGGAGAGG - Exonic
1181253430 22:21548015-21548037 TCCCCAGAAGGGGTCTGGAGAGG + Exonic
1181539381 22:23565383-23565405 TCTCCATAGGAGGCCTGGGGAGG + Intergenic
1182250028 22:28992646-28992668 TCTCCAGAAGAGAGCTGGTGGGG + Intronic
1182250611 22:28997161-28997183 TGACCAGAGAAGGCCTGGTGAGG - Intronic
1183241513 22:36661166-36661188 TCTCTAGAGGAGTCCGGAAGTGG + Intronic
1183346930 22:37313144-37313166 TCGCCAGTGGGAGCCTGGAGAGG + Intronic
1184240577 22:43209521-43209543 TCTCAAGAGGAGCCCTGACGGGG + Intronic
1184286438 22:43474352-43474374 TGGCCAGTGGAGGCCTGGACAGG + Intronic
1184382663 22:44155558-44155580 TCTCCCCAGGAGGTCTGGGGTGG - Intronic
1184523248 22:45007892-45007914 TCCCCGGAGGGGGCCCGGAGGGG + Intronic
1185210082 22:49565722-49565744 TCTACAGAGGGGTCCTGGGGAGG + Intronic
1185226806 22:49658013-49658035 ACTCCAGAGAAAGCCAGGAGAGG - Intergenic
1185316537 22:50181607-50181629 CCCACAGAGGAGGCCTGGAGGGG + Intergenic
1185342636 22:50298485-50298507 ACTCCAGATGAGGCCAAGAGTGG + Intronic
1185345673 22:50309545-50309567 TGTGCAGAAGAGGCCTGGGGTGG - Exonic
1185397913 22:50601780-50601802 TGTCCTGGGGAGGCCTGGAAAGG - Exonic
950449292 3:13056554-13056576 TCTGCTGAGGAGGCTTGGGGAGG - Intronic
950900576 3:16493663-16493685 TCTCCAGCAGGGGCCTGCAGGGG - Intronic
951631471 3:24725948-24725970 TCTACAAAAAAGGCCTGGAGAGG + Intergenic
953377073 3:42437658-42437680 TGTCCAGAATAGGCCAGGAGAGG + Intergenic
953960700 3:47263693-47263715 CCTTCAGAGGAGGCCAGGATGGG - Intronic
954116318 3:48468763-48468785 ACTCCAGATGTGCCCTGGAGAGG + Exonic
954390213 3:50264745-50264767 GCTCCAGAGGAGGGAGGGAGAGG + Intergenic
955189065 3:56743496-56743518 TTTCCAGATGAGGCTTAGAGGGG - Intronic
956606502 3:71078120-71078142 TATACAGAGGAGGCCGGGCGGGG - Intronic
957865040 3:86012508-86012530 TGCCCTGAGGAGGCCGGGAGCGG + Intronic
959688220 3:109170583-109170605 TTTCCATAGGAGGCAAGGAGAGG + Intergenic
960173675 3:114492379-114492401 ACACCAAAGGAGGACTGGAGTGG - Intronic
960400872 3:117196739-117196761 TCTCCTCAGAAGGCATGGAGAGG - Intergenic
962371265 3:134822608-134822630 TCTCCAGGGAGGGCTTGGAGTGG - Intronic
963176060 3:142299004-142299026 TATCCAGAGGAGGGATGGGGAGG - Intergenic
967813639 3:193781107-193781129 TCCCCAGACGGGGCATGGAGGGG + Intergenic
967820636 3:193835875-193835897 ACTCCAGACGGTGCCTGGAGAGG - Intergenic
967963286 3:194941953-194941975 GGTGGAGAGGAGGCCTGGAGGGG - Intergenic
968426288 4:525788-525810 TTTCCAGAGAAGCCCCGGAGAGG + Intronic
969185091 4:5468770-5468792 TATCTAGAGGAGGCCGGGCGCGG + Intronic
969327014 4:6449950-6449972 GCTCCCGGGGAAGCCTGGAGAGG - Intronic
969422901 4:7107632-7107654 GCTCCAGAGGAGGCGGGCAGAGG + Intergenic
970194708 4:13542714-13542736 TCCCCAGAAGAGGCCTAGATGGG - Intronic
970401253 4:15719835-15719857 TGTCTTGAGGAGGCATGGAGTGG - Intronic
971253093 4:24989477-24989499 CCTGCTGAGGAGACCTGGAGGGG + Intergenic
971670514 4:29549536-29549558 CCTCCAGAGGATGCCTGGGATGG - Intergenic
972879766 4:43409047-43409069 AATGCAGAGGAGGCCGGGAGTGG + Intergenic
979499463 4:121422590-121422612 TCACGAGAGGAGGCCGGGTGCGG - Intergenic
980174370 4:129326774-129326796 ACTCCAGAGGAAGCATGCAGTGG - Intergenic
980993959 4:139762882-139762904 TTTCCTGAGGAGGGCTGGAGAGG + Intronic
984797807 4:183680981-183681003 TCTACACAGGAGGCCAGGCGCGG - Intronic
984947347 4:184980104-184980126 TCTGCAGAGGAGGCTGGAAGGGG - Intergenic
985570998 5:644861-644883 TCTCCCGAGCAGGCCTGCTGTGG + Intronic
985898256 5:2763543-2763565 TCTGGAGAGGAGGCCAGGAGAGG - Intergenic
986729961 5:10628076-10628098 TCTCCAGACCAGGCCAGTAGAGG - Intronic
988263783 5:28926413-28926435 CCTCCAGGGGAGGCCAGGTGGGG + Intergenic
988524802 5:31977653-31977675 TGTCCAGAATAGGCCTGGTGAGG + Intronic
988584777 5:32499040-32499062 TCTCCAGGGGAGGATGGGAGTGG + Intergenic
992229024 5:74645060-74645082 ACTCCTAAGGAGGCCAGGAGTGG - Intronic
993926635 5:93873742-93873764 CCTCCATATGAGGCCAGGAGAGG - Intronic
994891145 5:105638526-105638548 TCTACAGGGGAGGACTGGACTGG + Intergenic
995315876 5:110773674-110773696 TCTCTAAAGGAGGCATGGGGGGG - Intergenic
995534171 5:113119015-113119037 ACTCCATAGCAGGCCTGCAGTGG - Intronic
995601772 5:113805180-113805202 TTTTCAGAGGAAGCCTGGAATGG + Intergenic
995805762 5:116050684-116050706 TCTCCAGAGGAGGCTTCCACAGG - Intronic
997368416 5:133340364-133340386 TCTCCAGAGGAAACCTCCAGGGG + Intronic
998136336 5:139676389-139676411 TCTGCGGAGGAGGCCTGGGGAGG - Intronic
999410351 5:151344915-151344937 TCCCCAGATGAGGTCTGGCGGGG + Intronic
1001596521 5:172902281-172902303 TCCCCGTAGGAGGCCCGGAGTGG + Intronic
1001741114 5:174053425-174053447 TCTGCAGGGGAGGCCTGAAAGGG + Intronic
1002134069 5:177097436-177097458 AGGCCAGATGAGGCCTGGAGGGG - Intronic
1002921312 6:1575290-1575312 CCTACAGAGGAGGCCTGGCCAGG - Intergenic
1002924794 6:1599159-1599181 CCACCTGCGGAGGCCTGGAGAGG + Intergenic
1003786121 6:9489254-9489276 TCTCTAGAGGAGGCCAGACGTGG + Intergenic
1004319048 6:14618290-14618312 TGCCCAGAGGAGGCCTGAACAGG - Intergenic
1006470083 6:34223818-34223840 TCTTGAGAGGAGGCCAGGGGAGG - Intergenic
1007817036 6:44531799-44531821 ACACCAGAGGAGCCCTGGGGTGG + Intergenic
1008535869 6:52505806-52505828 TCTCCAGAAGAGACCCCGAGTGG + Intronic
1013301431 6:108808490-108808512 TCTCCAGGGGAGGGCTGCAAAGG + Intergenic
1015551686 6:134418821-134418843 TGTCCACAGGAGGCTGGGAGAGG - Intergenic
1015651422 6:135465165-135465187 TCTCTAGAGGAGAACTGCAGGGG + Intronic
1016882842 6:148927994-148928016 TCCCCAGTGAAGGCCTGGAGGGG + Intronic
1018634413 6:165848374-165848396 CGTGCAGAGGAGGCGTGGAGTGG + Intronic
1018864544 6:167736638-167736660 GCTCCAGATGCGGCCTGGGGCGG + Intergenic
1019631229 7:2050852-2050874 TCTCCAGGAGGGGCCTAGAGAGG + Intronic
1020681745 7:11245536-11245558 TCTAGGGAGGAGGTCTGGAGTGG + Intergenic
1021076828 7:16315485-16315507 TCCCCAGAGGATGACTAGAGTGG + Intronic
1022401748 7:30045138-30045160 TCTCCTGAAGATGCCTGGAAAGG + Exonic
1023130615 7:36999200-36999222 GCTCCAGATGAGGCATGGAGAGG - Intronic
1023843085 7:44107573-44107595 TCCCCAGAGTAGGCCTGGGTGGG + Intronic
1025856623 7:65285945-65285967 TTTACAAAAGAGGCCTGGAGAGG - Intergenic
1027575636 7:79927221-79927243 TATTCAGAGGAGCTCTGGAGAGG + Intergenic
1028114347 7:86980935-86980957 TCTCCAAGGCAGGCCTGGAGAGG + Intronic
1029478901 7:100801342-100801364 ACTCCAGAAGAGGGCTGTAGAGG + Intergenic
1029711989 7:102304727-102304749 CCTGCAGTGGAGGCCTGGACTGG - Intronic
1030348047 7:108455620-108455642 TCTCCAGTCGCTGCCTGGAGAGG - Intronic
1032196065 7:129789198-129789220 TGTGCAGTGGAGGCCTGCAGTGG + Intergenic
1034406374 7:150905527-150905549 TCAGCAGAGGAGGCCTGGAGAGG + Intergenic
1034425838 7:151013613-151013635 TCTCCGGAGCGGGCCTGGTGGGG - Intronic
1034800238 7:154051782-154051804 TCTCCGGAGGAGGGCAGGAAAGG - Intronic
1034881622 7:154767190-154767212 TCAGCAGAGGAGCCCTGCAGTGG - Intronic
1035642856 8:1197215-1197237 TTTCCAGAAGAGACCTGAAGTGG - Intergenic
1036219285 8:6907780-6907802 TTTGCAGAGGAGGCCCAGAGAGG + Intergenic
1036782211 8:11657614-11657636 TCTTCACAGGAGGCATAGAGGGG + Intergenic
1037269855 8:17114827-17114849 ACCCCAGAGGAGGCCGGGCGCGG + Intronic
1037967352 8:23145105-23145127 TCTCCTGAGCAGGCGGGGAGGGG + Intronic
1038703312 8:29871545-29871567 ACTCCAGAGGACACCTGCAGAGG + Intergenic
1039801063 8:40954783-40954805 TCTCCAGAGGAGGGAGGGAAGGG - Intergenic
1039839849 8:41285727-41285749 TCTTCAGAGGAGGCATGGCAGGG - Intronic
1041207317 8:55511937-55511959 GCTCCAGAGGGGGAGTGGAGTGG + Intronic
1041280737 8:56209775-56209797 TCTGCAGAGGAGGGATAGAGAGG - Intronic
1041307024 8:56472132-56472154 TTTGTAGAGGAGGCTTGGAGAGG - Intergenic
1041530454 8:58859963-58859985 TCTGCAGAGGAGGCCAGGCAAGG - Intronic
1042950775 8:74198866-74198888 AGTCCAGAGGGGGCCTGGAATGG - Intergenic
1044624905 8:94227465-94227487 TCCCAAGGGGAGCCCTGGAGTGG - Intergenic
1044919716 8:97155964-97155986 TCTCAACATGAGGTCTGGAGGGG - Intergenic
1046708150 8:117478569-117478591 TCTTCAGAGGAGGCCTGCATTGG + Intergenic
1047819876 8:128507186-128507208 TCATCTGAGGAGGCGTGGAGGGG + Intergenic
1048710264 8:137202046-137202068 TCTGCAGAGCAGGCCTACAGTGG + Intergenic
1048855107 8:138680291-138680313 TCTCCTGAGGAGCCCTGTAGGGG + Intronic
1049003169 8:139838852-139838874 TCTCCACAGCAGGGCTGGACGGG - Intronic
1049337901 8:142096254-142096276 CCTGCAGAGGCTGCCTGGAGAGG - Intergenic
1049480373 8:142819696-142819718 TCTCCAGAATACTCCTGGAGAGG - Intergenic
1049748620 8:144273390-144273412 ACTCCAGTGGAGGCCTCGTGGGG + Intronic
1049754176 8:144301574-144301596 GCTCCAGAAGAGGCCGGGCGCGG + Intronic
1050609405 9:7336071-7336093 TATCCAGATGAGGCTTGGTGCGG + Intergenic
1051140378 9:13972407-13972429 TTTACAGATAAGGCCTGGAGAGG - Intergenic
1051444611 9:17127018-17127040 TCCCCAGATGAGGCCAGGCGCGG - Intergenic
1053427386 9:38019402-38019424 TCCAGAGAGGAGGCATGGAGAGG - Intronic
1054152071 9:61614306-61614328 TCTGAAGAGGAAGCCTGGAATGG + Intergenic
1054451205 9:65404379-65404401 TTTCCAGATGAGGCCTGGGCCGG + Intergenic
1056262393 9:84862067-84862089 TGGCCAGATGGGGCCTGGAGGGG + Intronic
1056714099 9:89014134-89014156 TCTCCAGTGGGGGACTGCAGGGG - Intronic
1057428834 9:94976327-94976349 TCTCTAGGGGTGGCATGGAGTGG - Intronic
1057499429 9:95585060-95585082 GCTCCTGATGATGCCTGGAGGGG - Intergenic
1057749635 9:97781416-97781438 TCTTCAGAGGAGGAATGGTGAGG - Intergenic
1059411397 9:114134628-114134650 TCTCCAGGGGATGCCTTGAGAGG - Intergenic
1059941914 9:119367900-119367922 ACTCCAGGGGAGCCATGGAGAGG + Intronic
1060268170 9:122124344-122124366 TCTGGAGAGGATGTCTGGAGAGG - Intergenic
1060587225 9:124794160-124794182 TCCCCAGAGGATCTCTGGAGTGG + Intronic
1060942276 9:127549869-127549891 GCTCCAGAGGGGGCCAGAAGGGG + Intronic
1061035879 9:128114159-128114181 GCTCCAGGGGAGCCCTGGGGCGG + Intergenic
1061281069 9:129597814-129597836 TCCCCAGAGGAGTCCTGGGCAGG - Intergenic
1061403485 9:130381307-130381329 TCTCCAGTGGGGGCCTGGTTAGG - Intronic
1061633046 9:131885593-131885615 TGACCAGAGGAGGACTGGACTGG - Intronic
1062151515 9:135021603-135021625 AGGCCAGAGGAGGCCTGCAGGGG - Intergenic
1062271715 9:135712910-135712932 TCCCCAGATGTGGCCTGGGGAGG - Intronic
1062414060 9:136439176-136439198 GCTCCAGTCGAGGCCTGGCGGGG + Exonic
1062495815 9:136831191-136831213 TCTCCAGAGTCTGCCTGGCGTGG - Intronic
1185606132 X:1367952-1367974 TCACGAGAGGAGACGTGGAGGGG + Intronic
1186801469 X:13096577-13096599 TATACAGAGGAGGCCGGGCGTGG - Intergenic
1189792706 X:44619041-44619063 TCTTCAGAGAAGGCCTCAAGGGG - Intergenic
1190059721 X:47202934-47202956 TTCCCGGAGCAGGCCTGGAGAGG - Exonic
1191616785 X:63177662-63177684 TCTGGAGAGCAGGCCTTGAGTGG + Intergenic
1191619512 X:63201261-63201283 TCTGGAGAGCAGGCCTTGAGTGG - Intergenic
1194638398 X:96373569-96373591 GCTCCAGTGGATGCCTTGAGAGG + Intergenic
1199673825 X:150167733-150167755 TCTACAGAGGTGGCATGAAGAGG + Intergenic