ID: 1169344711

View in Genome Browser
Species Human (GRCh38)
Location 20:4821231-4821253
Sequence GCTCCTAAGATGGCACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169344702_1169344711 24 Left 1169344702 20:4821184-4821206 CCAAAGGATTGAAAACAAGGTGT 0: 1
1: 0
2: 3
3: 30
4: 352
Right 1169344711 20:4821231-4821253 GCTCCTAAGATGGCACAAACTGG 0: 1
1: 0
2: 1
3: 9
4: 147
1169344707_1169344711 -7 Left 1169344707 20:4821215-4821237 CCGCCACACCAACTGGGCTCCTA 0: 1
1: 0
2: 1
3: 19
4: 197
Right 1169344711 20:4821231-4821253 GCTCCTAAGATGGCACAAACTGG 0: 1
1: 0
2: 1
3: 9
4: 147
1169344708_1169344711 -10 Left 1169344708 20:4821218-4821240 CCACACCAACTGGGCTCCTAAGA 0: 1
1: 0
2: 1
3: 17
4: 113
Right 1169344711 20:4821231-4821253 GCTCCTAAGATGGCACAAACTGG 0: 1
1: 0
2: 1
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169344711 Original CRISPR GCTCCTAAGATGGCACAAAC TGG Intronic
902809809 1:18881767-18881789 GCCCATCAGCTGGCACAAACTGG + Exonic
903576717 1:24343944-24343966 GCTCCCAAGATGGCAAAGAGAGG - Intronic
905361726 1:37425458-37425480 TCTCCTGAGCTGGCACAAGCTGG - Intergenic
905949486 1:41936812-41936834 GCTCTTATGATGGGACACACTGG + Intronic
908588689 1:65604670-65604692 GTTCCTAAGAGGCCACAGACAGG - Intronic
910101993 1:83587249-83587271 TCTCCTAAGAAGGCAAAAATTGG + Intergenic
910299021 1:85684397-85684419 GCCCCAAAGAGGGCAAAAACTGG + Intronic
911790749 1:102012819-102012841 GCTTTTTAGATGGCAAAAACTGG - Intergenic
914335776 1:146713962-146713984 GTTCCTAACAGGCCACAAACTGG - Intergenic
916797780 1:168182512-168182534 GCTCCTAGGAAGGCTGAAACAGG + Intronic
917912751 1:179668240-179668262 GCTCCTCAGAAGGGACAAAAAGG - Intronic
919967116 1:202538931-202538953 TTTCCTAAGATGCCACAATCGGG - Intronic
920737494 1:208546441-208546463 GCTCCTAAGAGACCACATACAGG + Intergenic
921304659 1:213783671-213783693 GCTCCAAAGATGACAGAAAGTGG - Intergenic
1063356365 10:5402617-5402639 GTTCCTAACAGGGCACAGACTGG - Intronic
1065144391 10:22753734-22753756 GCTCCCAAGTTGGCACAGAGGGG + Intergenic
1066186231 10:33013180-33013202 GCTCCTCAAATGCCACAAAGTGG - Intergenic
1069943491 10:71970756-71970778 GCTTCTCAGATGCCACAAAATGG - Intronic
1072266064 10:93729062-93729084 GCTTCTAACATGGCAGGAACAGG - Intergenic
1076621200 10:131789221-131789243 GCTCCTAACAGGCCACAGACTGG - Intergenic
1077256406 11:1585384-1585406 GCCCTAAAAATGGCACAAACAGG - Intergenic
1078248078 11:9594565-9594587 GTTCCTAACAGGGCACGAACTGG + Intergenic
1078734518 11:14007741-14007763 GCTCCTAACAGGCCACAGACTGG + Intronic
1081263659 11:40991937-40991959 GTTCCTAAGAGGCCACCAACTGG + Intronic
1081294180 11:41365049-41365071 GTTCCTAACAGGCCACAAACTGG - Intronic
1087720067 11:101653073-101653095 GCTCCCAAGATGGCAGTCACAGG - Intronic
1094645773 12:32322576-32322598 GTTCCTAATAGGCCACAAACTGG + Intronic
1099195293 12:79608522-79608544 GCTCCTAACAGGCCACAGACAGG + Intronic
1099871614 12:88356478-88356500 GCTCCTAATAGGCCACAGACTGG - Intergenic
1100386694 12:94110434-94110456 GATCCTAATAGGCCACAAACTGG - Intergenic
1104246816 12:127050992-127051014 GCTCCTAACAGGCCACAAACTGG - Intergenic
1104538479 12:129640716-129640738 GCTCCTAACAGGCCACAGACTGG - Intronic
1106658314 13:31771261-31771283 GTTCCTAACATGCCACAGACTGG - Intronic
1107749568 13:43550189-43550211 GTTCCTAACAGGCCACAAACTGG + Intronic
1112158023 13:96838546-96838568 GCTCCTCAGATGGCACAAAATGG - Exonic
1112234296 13:97621690-97621712 GGCCCTATGAAGGCACAAACTGG + Intergenic
1113538203 13:111084344-111084366 GCTCCTCAAATGCCACAAAGTGG + Intergenic
1113677985 13:112221605-112221627 GCTCCTCAAATGCCACAAAGTGG - Intergenic
1115011508 14:28552732-28552754 GCTACTAAAAAGGCACATACTGG + Intergenic
1115955788 14:38777573-38777595 GCTCCTAACAGGCCACAAACTGG + Intergenic
1116623943 14:47242332-47242354 GCTCCTCAAATGCCACAAAGTGG - Intronic
1117281173 14:54242496-54242518 GTTCCTAACAGGACACAAACTGG + Intergenic
1118142089 14:63095077-63095099 GCTCCTAACAGGCCACAGACTGG + Intronic
1121078121 14:91085928-91085950 GTTCCTAAGAGGCCACAAACTGG - Intronic
1127809502 15:62551262-62551284 GTTCCTAACAGGGCACAGACTGG + Intronic
1132033359 15:98457536-98457558 GCTCCTAACAGGCCACAGACTGG + Intronic
1134901522 16:17942362-17942384 GCTCCTGACAGGGCACAAACTGG + Intergenic
1136107092 16:28037787-28037809 GGTCCAAAGAGGGAACAAACAGG - Intronic
1137836641 16:51598448-51598470 GTTCCTAAGAGGCCACAGACTGG + Intergenic
1138313697 16:56050145-56050167 GTTCCTAACAGGCCACAAACCGG - Intergenic
1139997848 16:70997266-70997288 GTTCCTAACAGGCCACAAACTGG + Intronic
1140920337 16:79531792-79531814 GTTCCTAAGAGGCCACAGACTGG + Intergenic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1145407665 17:22620041-22620063 GCTACTAAGATGCCCCCAACAGG + Intergenic
1146876495 17:36416895-36416917 GCTACTAGGATGGCTGAAACAGG - Intronic
1147062889 17:37895966-37895988 GCTACTAGGATGGCTGAAACAGG + Intergenic
1149921361 17:60662885-60662907 GCTAGTAGGATGGCAAAAACGGG - Intronic
1152164839 17:78696279-78696301 GCCCCAAAGATGCCACAAATCGG + Intronic
1152268804 17:79311784-79311806 GCCCCCATGATGGCAGAAACGGG + Intronic
1153519319 18:5937266-5937288 GTTCCTAATAGGCCACAAACTGG - Intergenic
1159725331 18:71951005-71951027 TCTCCTCATATGGCACACACGGG + Intergenic
1164310386 19:24041203-24041225 GCTCCTCAAATGCCACAAAGTGG - Intronic
925564422 2:5235068-5235090 CCTCCTCATATGGCACAAATTGG - Intergenic
927437185 2:23076779-23076801 GCTCCTAAGAGGGCCCTACCTGG + Intergenic
931011142 2:57915758-57915780 GTTCCTAACAGGCCACAAACCGG - Intronic
931842159 2:66164807-66164829 GTTACTAAGATGGCAAAGACTGG + Intergenic
933739631 2:85523358-85523380 GTTCCTAACAGGGCACAGACTGG + Intergenic
936042358 2:109159612-109159634 GTTCCTAACAGGGCACAGACTGG - Intronic
938181363 2:129188086-129188108 GTTCCTAAGATGGCAAAACAAGG - Intergenic
939505181 2:143036801-143036823 TCTCCTAAAATGGAATAAACTGG - Intronic
940754573 2:157667295-157667317 GCTCCTTTGATGGCCCAAAGTGG + Intergenic
940986821 2:160059248-160059270 GTTCCTAACAGGCCACAAACTGG + Intronic
944777461 2:202981370-202981392 GTTCCTAACAAGGCACAGACTGG + Intronic
947860806 2:233355638-233355660 GGTCCTAACATGTTACAAACAGG + Intronic
1169193017 20:3669616-3669638 GCCCCAAAGATGGCCCACACAGG - Exonic
1169344711 20:4821231-4821253 GCTCCTAAGATGGCACAAACTGG + Intronic
1172623145 20:36332634-36332656 GCACCCAAGATGGCACAGGCGGG - Intronic
1172678514 20:36693521-36693543 GTTCCTAAGAGGGCACAGACTGG - Intronic
1172850019 20:37954900-37954922 GTTCCTAACAGGTCACAAACTGG + Intergenic
1174946251 20:54988819-54988841 GCTGCTATAATGCCACAAACTGG - Intergenic
1174986666 20:55461621-55461643 GTTCCTAACAGGCCACAAACTGG - Intergenic
1177093697 21:16803428-16803450 ACTCCTAAGAGGGCACACAATGG - Intergenic
1177832215 21:26151810-26151832 GCTCCTAACACGCCACAGACCGG + Intronic
1178889474 21:36509242-36509264 GCTCCCAAGATGGCGGACACCGG - Intronic
1180726792 22:17952379-17952401 GCTACTGAGATGCCACACACAGG - Intronic
1180999621 22:19981948-19981970 CATCCGAAGATGGCACAACCCGG - Exonic
1182246373 22:28961138-28961160 CCTTCCAAGATGGCACAAAAGGG + Intronic
949509857 3:4758416-4758438 GCAGCTAAGATGCCACAAAGGGG + Intronic
951554606 3:23908707-23908729 TCTCCTAAGTTGGAACATACTGG + Intronic
953322846 3:41987676-41987698 GCTCCTATGTTGGCACAGAAGGG - Intergenic
953715914 3:45316928-45316950 TCTCCTGAGCTGGCACAAGCTGG + Intergenic
955173412 3:56587470-56587492 GCATCTAACATGGCAGAAACAGG + Intronic
956390590 3:68769059-68769081 GTTCCTAACAGGCCACAAACTGG - Intronic
956514136 3:70027706-70027728 GCTTCTAAGATGGCAACATCTGG - Intergenic
959033663 3:101334133-101334155 GCTCCTAACAGGCCACAGACTGG + Intronic
959775910 3:110162784-110162806 GTTCCTAACAGGCCACAAACGGG - Intergenic
964920163 3:161886153-161886175 GCACATCAGATGGCAAAAACAGG - Intergenic
965769582 3:172167657-172167679 GTTCCTAACATGCCACAGACAGG - Intronic
971564556 4:28120754-28120776 GCTCCTAACAGGCCACAGACTGG + Intergenic
971755244 4:30699342-30699364 GTTCCTAACAGGCCACAAACTGG + Intergenic
973598781 4:52520419-52520441 GCTCCTGAGATGGCACAGGAGGG - Intergenic
987422110 5:17732706-17732728 GCTCATCACATGCCACAAACTGG - Intergenic
996713726 5:126569026-126569048 GCTCCTAATAGGCCACAGACTGG - Intronic
997811520 5:136975025-136975047 GTTCCTAAGAGGCCACAGACTGG + Intergenic
999146045 5:149395602-149395624 GCTCCTAAAATGTCATCAACTGG + Intronic
999559297 5:152782844-152782866 GTTCCTAACAGGGCACAGACTGG + Intergenic
999587234 5:153103423-153103445 GTTCCTAACAGGCCACAAACTGG - Intergenic
1000636488 5:163649797-163649819 GCTCCCAGGAAGGCATAAACAGG - Intergenic
1002195566 5:177499028-177499050 GTTCCTAACAGGCCACAAACGGG - Intergenic
1002323682 5:178390994-178391016 GTTCCTAACAGGCCACAAACTGG - Intronic
1004107107 6:12676095-12676117 GCTCTTAAGATGGATCAAACTGG + Intergenic
1004212355 6:13662272-13662294 GCTCAAAAGAAAGCACAAACAGG + Intronic
1005099635 6:22156649-22156671 GTGACTAAGATGGCAAAAACTGG - Intergenic
1007915084 6:45553681-45553703 GCCCCTAAGAAGACACAAAGAGG - Intronic
1008596188 6:53044161-53044183 GCTCCTAACAGGCCACAGACTGG - Intronic
1009962087 6:70535383-70535405 GTTCCTAAGAGGCCACAGACAGG - Intronic
1010656807 6:78521099-78521121 GCTGCTAAAATGGCATCAACAGG - Intergenic
1010776632 6:79894055-79894077 GTTCCTAACAGGCCACAAACCGG - Intergenic
1012257852 6:97054970-97054992 TCTCCAAAGATGCCACAAGCTGG - Intronic
1014720507 6:124911926-124911948 GCTCCTAATAGGCCACAGACTGG + Intergenic
1017093759 6:150785733-150785755 GTTCCTAACAGGTCACAAACTGG - Intronic
1018097021 6:160397366-160397388 GTTCCTAACAGGCCACAAACTGG + Intronic
1018800396 6:167217764-167217786 GCTCCTTAGAAGGCACAGGCTGG - Intergenic
1022146447 7:27546802-27546824 GCTCCTAAGAAGGTACACACTGG + Intronic
1023106140 7:36764891-36764913 ACTCCCAAACTGGCACAAACAGG - Intergenic
1023841623 7:44101552-44101574 CCTCCTCAGCTGGCACTAACAGG + Intergenic
1025280243 7:57621642-57621664 GCCCCTAAGATGGATCAGACTGG - Intergenic
1025304490 7:57843859-57843881 GCCCCTAAGATGGATCAGACTGG + Intergenic
1031826747 7:126575105-126575127 GTTCCTAACAGGCCACAAACCGG - Intronic
1034007991 7:147495809-147495831 GTTCCTAAAAGGCCACAAACTGG - Intronic
1036132751 8:6131697-6131719 GTTCCTAACAGGCCACAAACAGG + Intergenic
1036159700 8:6375693-6375715 GTTCCTAACAGGCCACAAACTGG - Intergenic
1036811494 8:11869912-11869934 GCTCATAAGATGGCCAAAATGGG + Intergenic
1036823021 8:11955061-11955083 ACCCCTAAGAGGGCACACACTGG - Intergenic
1038485878 8:27934899-27934921 TCTAGTAAGATGGCCCAAACTGG - Intronic
1045520606 8:102899826-102899848 CCTCATAAAATGGCACAAAGTGG + Intronic
1046363892 8:113200107-113200129 GTTATTAAGATGGCAAAAACTGG - Intronic
1047981791 8:130191098-130191120 GATTTTAAGATGGCACAAAGAGG + Intronic
1050131272 9:2415207-2415229 GCTCCTAACAGGCCACCAACAGG + Intergenic
1052390417 9:27872564-27872586 GTTCCTAACAGGCCACAAACTGG + Intergenic
1052985426 9:34483249-34483271 GCTCCTCAAATGCCACAAAGTGG + Intronic
1053451809 9:38199844-38199866 GCTCCTCACAAGGCACAACCAGG - Intergenic
1055883965 9:81036993-81037015 GCTCCTAAGATGTCACAGGCTGG - Intergenic
1059151734 9:111955290-111955312 GCTCCTAACAGGCCACAGACGGG + Intergenic
1059347999 9:113645343-113645365 GCTCCTAACAGGCCACAGACTGG - Intergenic
1061527830 9:131182296-131182318 GTTCCTAAGAGGCCACAGACCGG - Intronic
1062137457 9:134937249-134937271 GCTCCCATGATGGCCCAAACAGG + Intergenic
1062494590 9:136825716-136825738 GTTCCCAAGGTGGCACAAAGCGG - Intronic
1185601911 X:1345950-1345972 ACATCTAAGATGGCACACACTGG + Intronic
1189483881 X:41414260-41414282 GCTCCTAACAGGCCACAGACTGG - Intergenic
1189880212 X:45483181-45483203 GTTCCTAACAGGCCACAAACTGG + Intergenic
1190038654 X:47051038-47051060 GCTCCTAAGATGGTCCACCCCGG - Intronic
1192102263 X:68277370-68277392 GCTCCTAACAGGCCACAGACTGG + Intronic
1193538235 X:82738675-82738697 GCTCCTCAAATGCCACAAAGTGG + Intergenic
1194071668 X:89331501-89331523 GCTCCTCAAATGCCACAAAGTGG + Intergenic
1194903386 X:99542979-99543001 GCTCCAAAGATGGCTAAAATGGG + Intergenic
1198443428 X:136687354-136687376 CCTCCTAAAATGGCACCAAGTGG + Intronic
1200725912 Y:6667230-6667252 GCTCCTCAAATGCCACAAAGTGG + Intergenic