ID: 1169344947

View in Genome Browser
Species Human (GRCh38)
Location 20:4822629-4822651
Sequence CCGAGCGAGGCAGGTGCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169344947_1169344955 2 Left 1169344947 20:4822629-4822651 CCCACGGCACCTGCCTCGCTCGG 0: 1
1: 0
2: 1
3: 7
4: 69
Right 1169344955 20:4822654-4822676 CGAGAGAAGACGCCAGGCTGAGG 0: 1
1: 0
2: 1
3: 10
4: 170
1169344947_1169344954 -4 Left 1169344947 20:4822629-4822651 CCCACGGCACCTGCCTCGCTCGG 0: 1
1: 0
2: 1
3: 7
4: 69
Right 1169344954 20:4822648-4822670 TCGGGGCGAGAGAAGACGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 68
1169344947_1169344957 18 Left 1169344947 20:4822629-4822651 CCCACGGCACCTGCCTCGCTCGG 0: 1
1: 0
2: 1
3: 7
4: 69
Right 1169344957 20:4822670-4822692 GCTGAGGTCCCAGCGACCTCAGG 0: 1
1: 0
2: 2
3: 15
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169344947 Original CRISPR CCGAGCGAGGCAGGTGCCGT GGG (reversed) Intronic
900319199 1:2074225-2074247 CTGAGCGAGGCAGGGGCTGCTGG + Intronic
901526405 1:9825483-9825505 CCGGGCCAGGCAGGTGCTTTGGG - Intergenic
903389967 1:22956685-22956707 CAGAGCAAGGCAGGTGCGGAGGG - Intronic
904304350 1:29577945-29577967 CCGAGTGAGGCAGATACCGAGGG + Intergenic
920172546 1:204080747-204080769 CAGAGGCAGGCAGGTGCTGTGGG + Intronic
923471411 1:234294213-234294235 CCCAGGGAGGCAGGTTCCTTAGG + Intronic
1067090884 10:43265438-43265460 CCCAGCGAGGCGGGTGCAGCAGG - Intronic
1070329881 10:75409317-75409339 TAGAGCCAGGCACGTGCCGTCGG + Intergenic
1074182955 10:111079004-111079026 CCGAGCGAGCCAGGTGAAGCCGG + Exonic
1075488551 10:122847329-122847351 CAGAGCAAGGCAGGGGCCTTGGG - Intronic
1075723430 10:124600053-124600075 CCAAGTGAGGCAGGGGCAGTTGG + Intronic
1076337450 10:129717925-129717947 CAGAGCAAGGCAGGAGCTGTGGG - Intronic
1081807665 11:45899306-45899328 CCGAGCTAGGCAGGGGCCCCAGG + Intronic
1084315433 11:68342904-68342926 CCGAGGGAGGCAGGAGCTCTTGG - Intronic
1096392306 12:51238928-51238950 CCGAGGGTGGCAGAGGCCGTCGG + Intronic
1104969590 12:132525216-132525238 CCGACCGAAGGAGGTGCTGTGGG + Intronic
1111693375 13:91592819-91592841 GGCAGCCAGGCAGGTGCCGTGGG + Intronic
1112402165 13:99086637-99086659 CCGAGGGAGGCTGGTGGCATGGG - Intergenic
1116003271 14:39266902-39266924 CCGCCCGAGGCGGGTGCCCTTGG + Intronic
1116492882 14:45526892-45526914 CACAGCGAGGCAGGAGCCCTGGG - Intergenic
1129823827 15:78621245-78621267 CCGGGCTAGGCGGGCGCCGTAGG + Intronic
1136498509 16:30658429-30658451 CCGAGAGAGGAAGGAGGCGTAGG + Exonic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1144761367 17:17709443-17709465 CCGAGGCAGGCAGGGGCCTTGGG - Intronic
1144827703 17:18115670-18115692 GCCAGTGAGGCAGGAGCCGTGGG - Intronic
1145938201 17:28727045-28727067 CCGAGCGAGGCAGCTGCTTTCGG + Intronic
1145992241 17:29086131-29086153 CAGAGTGGGGCAGGTGCCATCGG + Intronic
1146573151 17:33969868-33969890 CCTAGCGAGGCAGGTGCTGTTGG - Intronic
1147683991 17:42276234-42276256 CCGAGCGAGGTAGGAGCTGCGGG - Exonic
1150343325 17:64386045-64386067 CTGAGCTAGGCGGGTGCAGTGGG + Intronic
1151359061 17:73577612-73577634 CTGAGAGAGGCAGGTGCTGTGGG + Intronic
1151780251 17:76240603-76240625 CCGCGCGAGGCACGCGCCGCCGG - Intergenic
1151815927 17:76471376-76471398 CTCAGAGAGGCAGGTGCCTTGGG + Exonic
1152197300 17:78925215-78925237 CCGAGCGGGGCAGGTGAGGAGGG - Exonic
1152597062 17:81242940-81242962 ACGAGCGAGGAAGGAGCCCTCGG + Intergenic
1153565684 18:6414987-6415009 CTGAGCGAGGCAGGTGCGGCGGG - Intronic
1160677294 19:398213-398235 CCCAGGGAGGCAGGTGCAGCTGG - Intergenic
1161094444 19:2381573-2381595 TGGAGCGAGGCAGGGGCGGTGGG - Intergenic
1161973406 19:7596189-7596211 CCGGGCGCGGCAGGTGCTGGGGG + Intronic
1162374211 19:10295510-10295532 CTGAGCGTGGCAGGCGCCATGGG + Exonic
1165860204 19:38905386-38905408 CTGAGCGAGGTAGGTGTCGGGGG - Exonic
1166856737 19:45786028-45786050 GCGAGCGAGGCAGGGGGCCTGGG + Exonic
1167668502 19:50836611-50836633 CAGAGAGAGGCAGGGGCCGAAGG - Intronic
1168108671 19:54180017-54180039 CCTAGCAATGCAGGTGCCGGGGG + Intronic
928092183 2:28381746-28381768 CAGAGTGAGGGAGGTGCCTTGGG + Intergenic
929791364 2:45025345-45025367 CCAAGCCAGGCATGTGCCCTGGG + Intergenic
938933880 2:136111801-136111823 CAGAGGGAGGCTGGTGCCTTAGG - Intergenic
948280923 2:236747606-236747628 CTGATGGAGGCAGGTCCCGTGGG + Intergenic
1169344947 20:4822629-4822651 CCGAGCGAGGCAGGTGCCGTGGG - Intronic
1171985087 20:31654630-31654652 CCAGGGGAGGCAGGTGCCCTTGG - Intergenic
1174285670 20:49471266-49471288 CGGAGTGAGGCAGGAGCCATAGG + Intronic
1175775693 20:61652087-61652109 AAGAGTGAGCCAGGTGCCGTGGG + Intronic
1178772897 21:35522038-35522060 CTGAGACAGGCAGGCGCCGTGGG + Intronic
1183033101 22:35120216-35120238 CCGGGGGAAGAAGGTGCCGTGGG - Intergenic
1184040985 22:41943484-41943506 CCGAGCGAGGCAGCTCCTGAAGG - Intronic
1184171848 22:42764678-42764700 GAGAGAGAGGCAGGTGCCGATGG - Intergenic
1185114571 22:48924533-48924555 CTGAGCGAAGCAGGTGCAGGTGG + Intergenic
954305704 3:49724216-49724238 CGGGGCGAGGCCGGGGCCGTGGG - Intergenic
956742955 3:72289274-72289296 CCCAGCGAGGCAGCCGCCGGAGG + Intergenic
960439143 3:117665511-117665533 CCGAGCAAGGCACCTGCTGTTGG + Intergenic
965590359 3:170356806-170356828 CCGGGCGAGGCCGGGGCCGCCGG + Intergenic
967201980 3:187079818-187079840 CCTTGGGAGGCAGGTGCTGTGGG - Intergenic
967930421 3:194686736-194686758 CCGAGCCTGGCAGGGGCCGGTGG + Exonic
969530295 4:7726725-7726747 CCGAGTGAGGCAGCGGCCGTGGG - Intronic
984801805 4:183722991-183723013 CCGAGCGAGGCGGGCGCCCTGGG + Intergenic
995753006 5:115473068-115473090 CCGAGGGAAGCAGGTGCCATGGG + Intergenic
1002045113 5:176537137-176537159 CCTCGCGAGGCAGACGCCGTCGG - Exonic
1002190146 5:177473638-177473660 CCGAGCGAGCCAGCGGCCGGGGG + Intronic
1005167508 6:22941351-22941373 CTGAGTGAGTCAGGTGCTGTTGG + Intergenic
1044971573 8:97625035-97625057 CCGAGAGAGGAAGGGGCCCTGGG - Intergenic
1049197443 8:141323543-141323565 CCCAGCGGGGCAGGATCCGTGGG - Intergenic
1049329634 8:142043314-142043336 CAGAGCAAGGCAGGTGCCCGAGG + Intergenic
1057997138 9:99828685-99828707 CTGAGCGCGGCAGCGGCCGTCGG - Exonic
1060977113 9:127771274-127771296 CCGAGAAAGGCAGGAGCCGCTGG - Intronic
1061248813 9:129414776-129414798 CCGGGCGAGGCGGGAGCCGGTGG + Intergenic
1061924612 9:133799905-133799927 CGGAGCGGGGCAGGTGCAGGCGG - Intronic
1062265493 9:135684909-135684931 CGGGGCGAGGCAGGTGCTGTTGG + Intergenic
1200048450 X:153415144-153415166 CCCAATGAGGCAGGGGCCGTTGG + Intergenic