ID: 1169345010

View in Genome Browser
Species Human (GRCh38)
Location 20:4822829-4822851
Sequence CCTAGAAGACGGCGGCGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169344998_1169345010 14 Left 1169344998 20:4822792-4822814 CCGCGCCGGGGACTGGGACCTGC 0: 1
1: 1
2: 1
3: 15
4: 178
Right 1169345010 20:4822829-4822851 CCTAGAAGACGGCGGCGGACTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1169345003_1169345010 -4 Left 1169345003 20:4822810-4822832 CCTGCCTCTGGGGAATCCGCCTA 0: 1
1: 0
2: 0
3: 7
4: 141
Right 1169345010 20:4822829-4822851 CCTAGAAGACGGCGGCGGACTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1169344997_1169345010 15 Left 1169344997 20:4822791-4822813 CCCGCGCCGGGGACTGGGACCTG 0: 1
1: 1
2: 2
3: 23
4: 205
Right 1169345010 20:4822829-4822851 CCTAGAAGACGGCGGCGGACTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1169344992_1169345010 22 Left 1169344992 20:4822784-4822806 CCGCCTCCCCGCGCCGGGGACTG 0: 1
1: 2
2: 1
3: 42
4: 308
Right 1169345010 20:4822829-4822851 CCTAGAAGACGGCGGCGGACTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1169345004_1169345010 -8 Left 1169345004 20:4822814-4822836 CCTCTGGGGAATCCGCCTAGAAG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1169345010 20:4822829-4822851 CCTAGAAGACGGCGGCGGACTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1169344996_1169345010 16 Left 1169344996 20:4822790-4822812 CCCCGCGCCGGGGACTGGGACCT 0: 1
1: 0
2: 3
3: 9
4: 115
Right 1169345010 20:4822829-4822851 CCTAGAAGACGGCGGCGGACTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1169344999_1169345010 9 Left 1169344999 20:4822797-4822819 CCGGGGACTGGGACCTGCCTCTG 0: 1
1: 1
2: 4
3: 48
4: 412
Right 1169345010 20:4822829-4822851 CCTAGAAGACGGCGGCGGACTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1169344995_1169345010 19 Left 1169344995 20:4822787-4822809 CCTCCCCGCGCCGGGGACTGGGA 0: 1
1: 0
2: 1
3: 14
4: 261
Right 1169345010 20:4822829-4822851 CCTAGAAGACGGCGGCGGACTGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169345010 Original CRISPR CCTAGAAGACGGCGGCGGAC TGG Intronic
903338022 1:22637731-22637753 CCTGGCAGACGGGGGCGGCCAGG + Exonic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
1063375398 10:5551503-5551525 CCCAGAAGACAGGGGCTGACAGG + Intergenic
1064384559 10:14878881-14878903 TCTACAAGATGGCGGCGGTCGGG + Exonic
1077873517 11:6283360-6283382 CATAGAAGACTGTGGTGGACAGG + Intergenic
1078168625 11:8911544-8911566 CCAAGAGGAGGGCGGTGGACTGG + Exonic
1086171954 11:83846289-83846311 ACTAGAAGACTGAGGCAGACTGG + Intronic
1091980221 12:4858549-4858571 CCCAGAAGACAGCAGCTGACAGG - Intergenic
1103956050 12:124577440-124577462 CATTTAAGACGGCGGCGGCCGGG + Intergenic
1124966725 15:34437420-34437442 CGGCGAGGACGGCGGCGGACCGG - Intronic
1125033173 15:35093140-35093162 CCCAGGCGGCGGCGGCGGACGGG + Intergenic
1133600078 16:7331110-7331132 TCTAGATAACGACGGCGGACAGG - Intronic
1139489612 16:67279343-67279365 CGGAGAGGACGGCGGCGGGCGGG + Exonic
1139805881 16:69565589-69565611 CCCAGAGGCCGGCGGCGGACGGG - Intronic
1143548562 17:7614719-7614741 CCAAGGCGGCGGCGGCGGACGGG - Exonic
1143662519 17:8334986-8335008 CCTAGAAGACGGAGACTGAAAGG - Intergenic
1151227548 17:72658162-72658184 CCTAGAAGATGGAGGGGGGCTGG + Intronic
1152628627 17:81399703-81399725 CCGAGGAAGCGGCGGCGGACCGG + Exonic
1152775624 17:82199963-82199985 CCCAGAAGACGGTGGCGCTCAGG + Intronic
1155083693 18:22434630-22434652 CCAAGAAGATGGTGGCCGACTGG - Intergenic
1159510900 18:69397366-69397388 ACTAGAAGTTGGCGGCGGAGCGG + Intergenic
1163654584 19:18538367-18538389 CCCTGAAGACGGCTGTGGACGGG - Exonic
944690095 2:202151023-202151045 CCCAGAAGACTGGGGCAGACAGG + Intronic
947472669 2:230412995-230413017 CCTAGAAGATGGGCGGGGACCGG + Intergenic
1169345010 20:4822829-4822851 CCTAGAAGACGGCGGCGGACTGG + Intronic
1170524752 20:17226827-17226849 CCCAGAAGGCGGAGGCGGCCGGG + Intronic
953598492 3:44339665-44339687 CCTGGAAGAGGGCAGAGGACCGG - Intronic
961779894 3:129315324-129315346 CCAAGAAGACGGCGGCCGCCGGG - Exonic
968921197 4:3522971-3522993 CCCAGAAGATGGCGGGGAACTGG + Intronic
969529043 4:7719710-7719732 CCTGGAAGTCGGCCCCGGACGGG - Intronic
973293466 4:48491161-48491183 CCGAGACGGCGGCGACGGACGGG + Exonic
974840198 4:67290527-67290549 CTTAGAAGACGGCAGGGGTCAGG - Intergenic
984883637 4:184430983-184431005 CCTAGAAGAGGGCGGAGCATGGG - Intronic
985565200 5:612075-612097 CCTAGAAGGCGGCCGCGCCCAGG + Intergenic
991243930 5:64489261-64489283 CCTAGAAGAGGCCAGCAGACAGG - Intergenic
1001546555 5:172574139-172574161 CCTAGAAGAAGGCAGGGCACAGG - Intergenic
1004720428 6:18264162-18264184 CCTGGACGGCGGCGGCGGAGCGG - Intronic
1040080084 8:43276149-43276171 CGAAGAGGACGGTGGCGGACGGG + Intergenic
1041271416 8:56113067-56113089 CCTCGAAGACGGCAGCGGAGAGG + Exonic
1055154023 9:73038804-73038826 CCTAGAAGACAGGGGAGGAGGGG - Intronic
1061992093 9:134164892-134164914 CCTAGCAGACGGCGGAAGGCGGG + Intergenic
1186242411 X:7583829-7583851 CCTAGAAGATATTGGCGGACAGG + Intergenic
1200448436 Y:3293921-3293943 CCTGGAAGAAGCTGGCGGACGGG - Intergenic