ID: 1169345801

View in Genome Browser
Species Human (GRCh38)
Location 20:4827302-4827324
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169345797_1169345801 4 Left 1169345797 20:4827275-4827297 CCTGGATGCTGCGTCTCCCCTAT No data
Right 1169345801 20:4827302-4827324 GACCTTTGACCTTAGAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169345801 Original CRISPR GACCTTTGACCTTAGAGCAG AGG Intergenic
No off target data available for this crispr