ID: 1169345936

View in Genome Browser
Species Human (GRCh38)
Location 20:4828121-4828143
Sequence CAGAAATATCTCATTAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169345933_1169345936 6 Left 1169345933 20:4828092-4828114 CCGTATAAGGAACTGTGTAGAAC No data
Right 1169345936 20:4828121-4828143 CAGAAATATCTCATTAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169345936 Original CRISPR CAGAAATATCTCATTAAAGG TGG Intergenic
No off target data available for this crispr