ID: 1169350591

View in Genome Browser
Species Human (GRCh38)
Location 20:4865068-4865090
Sequence GTCCTGGGGAAGCACCGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169350591_1169350604 22 Left 1169350591 20:4865068-4865090 CCTTCCCGGTGCTTCCCCAGGAC 0: 1
1: 0
2: 1
3: 21
4: 236
Right 1169350604 20:4865113-4865135 TCCATTCCCTGGAATCTCCTTGG 0: 1
1: 0
2: 2
3: 35
4: 354
1169350591_1169350599 -1 Left 1169350591 20:4865068-4865090 CCTTCCCGGTGCTTCCCCAGGAC 0: 1
1: 0
2: 1
3: 21
4: 236
Right 1169350599 20:4865090-4865112 CCTTTGCTTCCCCTCTCACAGGG 0: 1
1: 0
2: 4
3: 40
4: 361
1169350591_1169350597 -2 Left 1169350591 20:4865068-4865090 CCTTCCCGGTGCTTCCCCAGGAC 0: 1
1: 0
2: 1
3: 21
4: 236
Right 1169350597 20:4865089-4865111 ACCTTTGCTTCCCCTCTCACAGG 0: 1
1: 0
2: 1
3: 28
4: 287
1169350591_1169350603 11 Left 1169350591 20:4865068-4865090 CCTTCCCGGTGCTTCCCCAGGAC 0: 1
1: 0
2: 1
3: 21
4: 236
Right 1169350603 20:4865102-4865124 CTCTCACAGGGTCCATTCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169350591 Original CRISPR GTCCTGGGGAAGCACCGGGA AGG (reversed) Intronic
900096242 1:941248-941270 GGCCTGGCTCAGCACCGGGAGGG + Exonic
900519419 1:3098460-3098482 GTCTGGGGGAAGCACCTGGGTGG - Intronic
902801158 1:18831047-18831069 CTCCTGGGGAAGCCCAGGGTGGG + Intergenic
903626784 1:24736419-24736441 CTCATGGGGAAGCAACGGAAAGG + Intergenic
904603885 1:31688687-31688709 AGCCTGGGGCAGCACAGGGACGG + Intronic
904622401 1:31783202-31783224 ATCCTGGGGAAGCAGAGGCAGGG + Intergenic
904830182 1:33301239-33301261 GCCCTGTGGAAGCACTGTGAGGG + Intergenic
905901994 1:41587881-41587903 GTCCTATGGAAGCACCGGCATGG + Intronic
906130001 1:43450362-43450384 GTCCTGGGGCTGTACTGGGAAGG - Exonic
911069039 1:93817614-93817636 GACATGGAGAAGCACAGGGAAGG - Intronic
913640600 1:120808896-120808918 TTCCTGGGTAAGCACAGAGATGG + Intronic
915310309 1:155003073-155003095 GTGTTGGGAAAGCACAGGGAAGG - Intronic
916917717 1:169427532-169427554 GCCCTTCGCAAGCACCGGGATGG - Intronic
917821516 1:178768660-178768682 GTCCTGGGGAGGTGCTGGGAGGG + Intronic
919897089 1:202015675-202015697 GCCCTAGGGGAGCACCGTGATGG + Exonic
921995481 1:221413458-221413480 GTTCTGGGTTAGCACCAGGAGGG - Intergenic
922211160 1:223487768-223487790 GTCCTGGGAAACCACAGGGCGGG + Intergenic
1062908363 10:1195169-1195191 GACCTGGGGAAGGACAGGGATGG - Intronic
1065568406 10:27041374-27041396 GTGCTGTGGAAGCACCAGGCAGG - Intronic
1067550754 10:47234156-47234178 ATCCAGGGCAAGCACAGGGAAGG + Intergenic
1069642297 10:69963769-69963791 GTTCTGGTGAAGCTCCTGGAGGG - Intronic
1069752384 10:70752722-70752744 CTCCTGGGGAAGCAGGAGGATGG - Intronic
1070592726 10:77812055-77812077 GAACTGGGGAAACACCAGGATGG + Exonic
1070599285 10:77854449-77854471 GTACTGGGGAACCACTGGGCTGG - Intronic
1072661506 10:97366430-97366452 GTCCTGGGTAAGCACAGGGCTGG - Exonic
1075252403 10:120891946-120891968 GCTCTGGGGAAGCACCAGGATGG + Intronic
1075567322 10:123514068-123514090 GTCCTGGGGAAGGGGAGGGAAGG + Intergenic
1077074434 11:694108-694130 GTCCTGGAGAAGCCCTGGGGTGG - Intronic
1077095474 11:797287-797309 TGCCTGGGGAAGAACCGGCAGGG + Intronic
1077230856 11:1457620-1457642 GTCGTGGGGGAGCACCCGGCTGG + Intronic
1077919144 11:6630327-6630349 GTCCAGGCGAAGCGCCGGCACGG + Exonic
1078462947 11:11529113-11529135 ATCCTGGTGAAACACAGGGAAGG - Intronic
1081794560 11:45810646-45810668 GGCCTGGGGAGGAACGGGGAGGG + Intronic
1083944348 11:65915773-65915795 GCCCTGGGGAAGCTCAGGGTGGG + Intergenic
1083976012 11:66120915-66120937 GCCCTGTGGAAGCACAGGGCTGG - Intronic
1084029648 11:66473797-66473819 GTCCTGGTGATGCACCCGGCAGG + Exonic
1084620595 11:70267804-70267826 GTGCTGTGGAATCACAGGGAAGG - Intergenic
1084719540 11:70895432-70895454 GTCCTGTGGAAGCGCGGGGCTGG + Intronic
1084741068 11:71139963-71139985 GTGCTGGAGAAGCACCTGGGCGG - Intronic
1084991057 11:72925973-72925995 CTCCTGGGGGAGGGCCGGGAAGG + Intronic
1085713852 11:78854371-78854393 CTCCAGGAGAAGCCCCGGGAAGG - Intronic
1085923609 11:80988678-80988700 GTCCAGGGGAAGGAGTGGGAGGG + Intergenic
1085931235 11:81086085-81086107 TCCCTGAGGAAGCACCTGGATGG - Intergenic
1088750344 11:112837411-112837433 GTCCTGGAGAAGCACTTGGTGGG + Intergenic
1089008610 11:115113964-115113986 GGACTGGGGAAGCTCCAGGAAGG + Intergenic
1090802264 11:130180279-130180301 ATCCTGGGGAGGGACCGTGAAGG - Intronic
1091694972 12:2622324-2622346 GTCCTTGGAAACCACAGGGATGG + Intronic
1091820622 12:3472888-3472910 GTCTTGGGGAAGCGCTGGGAAGG + Intronic
1091968675 12:4767103-4767125 GGCCTGGTGAAGAAGCGGGAGGG - Intronic
1092759781 12:11799302-11799324 GCCCTAGGAAAGCACCGGGAAGG - Intronic
1094673667 12:32596631-32596653 GTCCTGGAGAAGTACATGGAAGG + Intronic
1095960804 12:47833240-47833262 GCCCTGGGGAGGGACTGGGAGGG - Intergenic
1096513385 12:52144057-52144079 GCCCTGGGGAAGGAGCTGGAGGG - Intergenic
1096659860 12:53117677-53117699 GGCCTGGGGAGGCAGTGGGAGGG + Intronic
1096660125 12:53119001-53119023 GGCCTGGGGAGGCAGTGGGAGGG + Intronic
1098150663 12:67543252-67543274 GTGCTGTGGAAACACCGAGAAGG + Intergenic
1098550442 12:71755433-71755455 GCCCTGGGGAATCACCAGGTCGG + Intronic
1099014205 12:77325354-77325376 GTCCTGGAGAAGCAGCAGGGAGG - Intergenic
1101372015 12:104138483-104138505 GGCCCGGGTCAGCACCGGGAAGG - Intergenic
1104047711 12:125174716-125174738 GTCCTGGGGAGGCCACTGGAGGG - Intergenic
1117129983 14:52676503-52676525 AGCCTTGGGAAGCACGGGGAAGG - Intronic
1117967398 14:61220075-61220097 GTACTGGAGAAGCCCTGGGAAGG + Intronic
1119329967 14:73786721-73786743 TTCCCAGGGAAGCACCGGGCAGG + Intronic
1120941665 14:89955800-89955822 GTCCTGGGTAAACACCCGGCGGG + Intronic
1121102529 14:91259897-91259919 GTGCTGGGGGAGGACAGGGATGG + Intergenic
1121582350 14:95040288-95040310 GACCTGGAGCAGCACAGGGAAGG + Intergenic
1121632722 14:95432781-95432803 GACCTGGGGAAGCACTGGAGTGG - Intronic
1122410493 14:101523231-101523253 GCCCTGTGGAAGCACCGTCAAGG - Intergenic
1122781130 14:104143999-104144021 AGCCTGGGGAAGGGCCGGGAGGG + Intronic
1122864052 14:104595569-104595591 GTCCTGGGTCAGGACAGGGAGGG - Intronic
1122895289 14:104753625-104753647 GTCCTGAGAAAGCACCAGGCGGG - Intronic
1125898041 15:43319103-43319125 TTCCTGGGGAAGGATAGGGAAGG - Intergenic
1127635214 15:60862708-60862730 GTTCTGGGCAAGCTCTGGGAAGG - Intronic
1127826587 15:62709194-62709216 GTCATGGGAGAGCACCGGGGTGG + Intronic
1128074966 15:64820218-64820240 GACCTGGGGCAGCACAGGGAAGG - Intronic
1128512514 15:68322105-68322127 GCCCTGGGGCAGGAGCGGGACGG + Intronic
1129705235 15:77790599-77790621 GCCCTGGGGAGGCCCCAGGAAGG + Intronic
1130149716 15:81302115-81302137 GGCCTGGGGCAGCACCTAGAGGG - Intronic
1131759496 15:95604979-95605001 GTCCGTGGGAATCACTGGGATGG + Intergenic
1132656176 16:1042903-1042925 GAGCTGGAGCAGCACCGGGAAGG - Intergenic
1133034279 16:3026345-3026367 GTCCTGGGGAAGGAAAGGCAAGG - Exonic
1133999248 16:10769986-10770008 GTCCTAGGGAAGGGCGGGGAGGG - Intronic
1136428763 16:30185382-30185404 GCCCAGGGGCAGCACCAGGAAGG - Exonic
1137404830 16:48181134-48181156 GTCCTGAAGCAGCAGCGGGAGGG + Intronic
1137508309 16:49076048-49076070 GCCCAGGTGAAGCACAGGGAGGG - Intergenic
1138597174 16:58035236-58035258 GTGCTTGGGAAGAACAGGGAGGG + Intronic
1139244359 16:65427153-65427175 GTCCTGGGGGAGCAGCGAGGAGG - Intergenic
1139370815 16:66468404-66468426 GTCACGGGCAAGCACCAGGAAGG - Intronic
1139476155 16:67203477-67203499 GTCCTGGGGAAGCAAGGGAGCGG - Exonic
1139511100 16:67429050-67429072 GTCCTGGGAAGGAACCGTGAAGG - Intergenic
1140977720 16:80076229-80076251 GTGCTGGGGAAGCACCTGGAGGG - Intergenic
1141741721 16:85898253-85898275 ATCCTGGGGAAGCCCTGGAATGG - Intergenic
1142501577 17:336094-336116 GGCCTCGGGAAGCACCGGCTCGG - Intronic
1142830062 17:2542151-2542173 TTCCTGGGGAAGCCCCAGGAGGG - Intergenic
1143619936 17:8075024-8075046 GTTGTGGGGAAGCCCAGGGAAGG - Intronic
1144422367 17:15110020-15110042 GGCCAAGGGAAGCACTGGGAAGG - Intergenic
1145783772 17:27581090-27581112 GTTCTGGAGAGGCATCGGGAAGG + Intronic
1146400795 17:32498489-32498511 GTCCTTGTGGAGCACCTGGAGGG - Intronic
1146652484 17:34615132-34615154 CTCCTGGGGAAACCCAGGGAGGG - Intronic
1146716187 17:35089039-35089061 GGCCTGGGGAAGGACGGGAAGGG - Intronic
1147187706 17:38721858-38721880 GTCCTGGGGAGGGAGGGGGAAGG - Exonic
1147420444 17:40319757-40319779 GTGCCGGGGAAGCCCCGGGTTGG + Intronic
1151102029 17:71566915-71566937 GGCGTGGGGAAGCACCAGGCAGG + Intergenic
1151305055 17:73257894-73257916 CTCCTGGGGAATCCCCTGGAGGG - Intronic
1151685214 17:75642256-75642278 GCTCTGGGGAAGCCCCGGGGAGG - Intronic
1152473343 17:80502636-80502658 TTCCTGGGGAAGCACATGGGTGG - Intergenic
1152755161 17:82084151-82084173 GTCCTGGGGATGCAGCAGGTGGG + Exonic
1154069177 18:11137662-11137684 GTCCAGGGAAAGCAGCAGGAGGG + Intronic
1156198110 18:34798495-34798517 TTCCTGGGGAAGCAGGGAGAAGG - Intronic
1160748540 19:722885-722907 GCCCCTGGGAGGCACCGGGAAGG + Intronic
1160779272 19:870745-870767 GTCCTGGGGCAGGACATGGAGGG + Intronic
1160918806 19:1510404-1510426 TTCCTGGGGAAGAACCGTGCTGG - Exonic
1161003041 19:1920764-1920786 GAGCTGGGGACGCACCGGGGAGG - Intronic
1161102084 19:2426301-2426323 GTCCTGGTGGAGCACCAGGCAGG - Exonic
1161318872 19:3631956-3631978 GTCCTGGGGAAGGGCAGGGTGGG + Exonic
1161421748 19:4179756-4179778 GGCCTGGGGAAGCCCCGTGGAGG + Intronic
1161443672 19:4306059-4306081 GTCCTGGGGAGGTAAGGGGAGGG + Intronic
1162016965 19:7851288-7851310 GTGCTGAGGGAGCACCAGGAAGG + Intronic
1162454858 19:10777231-10777253 GTGCTGGGGAAGCAGGAGGATGG + Intronic
1164540176 19:29116028-29116050 ATCCTGGGGGAGGACAGGGAGGG + Intergenic
1165707409 19:37986428-37986450 CTCCTGGGCAAGAACCGGGCTGG - Intronic
1165915242 19:39254560-39254582 GTCCAGAGGCAGGACCGGGAAGG + Intergenic
1166879596 19:45919725-45919747 CTCCTGGGGAGGCACCACGACGG + Intergenic
1166996673 19:46722804-46722826 GTCCCGGGGCAGCAGCGGTAAGG - Exonic
925152261 2:1623008-1623030 GGCCTGGGGAAGCCCCTGGCAGG - Intergenic
925770178 2:7274549-7274571 GTCCTGGGGAATCTCAGTGAAGG + Intergenic
926057977 2:9787211-9787233 GACCTTGGGAAGAACCTGGAGGG - Intergenic
926128495 2:10286139-10286161 GCCCAGGGGCAGCAGCGGGAGGG + Intergenic
928438202 2:31269675-31269697 GTCCTGAGGCAGCCCCTGGAGGG + Intergenic
931458577 2:62431695-62431717 GTGATGAGGAAGCACCAGGAAGG + Intergenic
932432321 2:71683369-71683391 GGGCTGGGGAAGCACAGGCAGGG - Intronic
935040384 2:99420563-99420585 CTACTGGGGAAGCACCAGGGTGG - Intronic
935697577 2:105783389-105783411 GTTCTGGGGTAGCACCGTGAAGG + Intronic
937975755 2:127581265-127581287 GGACTGGGGAACAACCGGGAAGG - Intronic
937981904 2:127620602-127620624 GTCCTGGAGAAGCATAGGCATGG - Intronic
937994704 2:127684242-127684264 GTGCTGGGGAAGAACAGGGCTGG + Intergenic
938239350 2:129731221-129731243 GGCCTGGGGGAGCCCCGGCAGGG + Intergenic
940498913 2:154469912-154469934 GACCTGGGTAAGCACCTTGATGG - Intergenic
942641546 2:178066487-178066509 GTCCTGGGCAGGCAGTGGGAGGG - Intronic
943763608 2:191636347-191636369 GTCCTAGGGGAGCACAGAGAAGG + Intergenic
943879377 2:193120227-193120249 GTCTTGGGTAAGGACAGGGAAGG + Intergenic
944276850 2:197848867-197848889 GTCCTGGGGAAGTAAAGAGACGG + Intronic
947815838 2:233035424-233035446 TTCCTGGGGAAGAACTGAGATGG + Intergenic
948684477 2:239661606-239661628 GCCCTGAGGAAGCCCTGGGAAGG - Intergenic
1168800531 20:641797-641819 TCCCTGCGGAAGCAGCGGGAGGG - Intergenic
1168921074 20:1536902-1536924 GTCATGGGGAAACGCCTGGATGG + Intronic
1169331933 20:4722995-4723017 GGCCTGGGGGAACACCAGGAGGG - Intronic
1169350591 20:4865068-4865090 GTCCTGGGGAAGCACCGGGAAGG - Intronic
1172840500 20:37900344-37900366 GCACAGGGGAAGCACTGGGAAGG + Intergenic
1173135274 20:40433618-40433640 GGCCTGGGGAAGCTTGGGGAGGG + Intergenic
1173743867 20:45421488-45421510 GTCCAGCAGCAGCACCGGGAAGG - Exonic
1174368307 20:50069625-50069647 CTACTGGGGAAGCTCAGGGATGG + Intergenic
1174575277 20:51532830-51532852 GTCCTTGGGGGGCACAGGGAGGG + Intronic
1176057001 20:63154366-63154388 GTCCCTGGGAGGCAGCGGGAGGG - Intergenic
1176674650 21:9767335-9767357 GCCCTGCGGAAGCTCAGGGAGGG - Intergenic
1176674822 21:9768213-9768235 GCCCTGCGGAAGCTCAGGGAGGG - Intergenic
1176674910 21:9768593-9768615 GCCCTGCGGAAGCTCAGGGAGGG - Intergenic
1180001083 21:44995848-44995870 GACCTGGGGACGCAGCGGCAAGG + Intergenic
1180158955 21:45990543-45990565 GACCAGGGGAAGGACGGGGAGGG + Intronic
1180920151 22:19517409-19517431 GTGCTGGGGAAGCAGTGGGCAGG - Intronic
1181025155 22:20123601-20123623 TTCCTGGGGAGGAAACGGGAGGG + Intronic
1182148192 22:28010463-28010485 GCGCTGGGGAAGCACTGGGATGG + Intronic
1183368704 22:37420283-37420305 GTCCTGGGGGCGCACGGGGCGGG - Intronic
1183391122 22:37546164-37546186 GAGCTGGGGAGGCCCCGGGATGG + Intergenic
1184075774 22:42176561-42176583 CTCCTGGGGAAGCACAGAGAGGG + Intronic
1184595649 22:45512442-45512464 GTCCTGGGCAGGCACTGAGAAGG + Intronic
1184656247 22:45943588-45943610 GCCCTGGGGCAGCCCCGGGGAGG - Intronic
1184731830 22:46374903-46374925 GGCCTCGGGAAGCACCTGGGAGG + Intronic
1185050925 22:48553555-48553577 GTCCTGGGGCAGGGCTGGGAGGG + Intronic
1185144589 22:49124100-49124122 GGCCAGGGGAGGCACGGGGATGG - Intergenic
950661048 3:14467202-14467224 GCCCTTGGGAAGCAACCGGAAGG - Intronic
951110842 3:18802046-18802068 GTCATGGGGAAGCAGCCAGATGG - Intergenic
953473012 3:43182643-43182665 GTCCTGGGAAGGCACTGGGCTGG + Intergenic
953704126 3:45218534-45218556 GTCCTGGTGGGGCACCTGGAAGG + Intergenic
954334700 3:49909510-49909532 GTCCTAAGGGAGCACCTGGAGGG - Intronic
954522624 3:51242881-51242903 GTCCTGGGGAAGCTGCAGTATGG + Intronic
954628608 3:52036226-52036248 GCCCTGGGGATGCACCGTCAGGG - Intergenic
954795647 3:53160322-53160344 GTCCTGGGGAACCACCTAGAAGG - Intronic
961634735 3:128326066-128326088 GTGCTGGGGGAGCATCTGGAGGG + Intronic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
962318854 3:134374870-134374892 GTCCTGGGGTTGCTGCGGGAGGG + Intronic
967191828 3:186991411-186991433 GTGCTGTGGGAGCACAGGGAAGG + Intronic
967858982 3:194137706-194137728 GTGCTGGGGAAGTACCGAGCCGG + Exonic
968510308 4:992643-992665 GTCCCGAGGCAGCACCGAGAGGG + Intronic
968689525 4:1983556-1983578 GGCCTGGGGGTGCACCGGGCCGG - Intronic
968972968 4:3805685-3805707 GTCCTGGGGCATCGCAGGGAAGG - Intergenic
971177070 4:24292421-24292443 TTCCTGGAGAAGCATCAGGAAGG + Intergenic
972396893 4:38664924-38664946 GTGGTGGGGGGGCACCGGGAGGG - Intronic
972767735 4:42167072-42167094 TTGATGGGGAAGCACAGGGAAGG + Intergenic
976267055 4:83194634-83194656 GTCCTGAGGAAGGGCAGGGATGG - Intergenic
977507019 4:97915522-97915544 ATCCTGGGGAAGCTCCAGGAAGG + Intronic
979225387 4:118278690-118278712 TTCCGGGGGAAGCGCCGCGAGGG - Intergenic
980894427 4:138848370-138848392 GTCCTGGAGAGGCACCAGGAGGG - Intergenic
985372540 4:189301636-189301658 GGCCTGGGGAAGCCCAGTGAGGG - Intergenic
985400644 4:189590102-189590124 GCCCTGCGGAAGCTCAGGGAGGG + Intergenic
986055517 5:4132932-4132954 CTCCTGTGGCATCACCGGGATGG - Intergenic
988796330 5:34656405-34656427 TTCCTGGGGAAGCGGCGGGCGGG + Intronic
995024694 5:107406378-107406400 GGCCTGGAGAAGCACCAAGAAGG - Intronic
998819935 5:146049148-146049170 GTCCTGGGGAAGTGCCAGGACGG + Exonic
999928615 5:156406572-156406594 TTCCTGGGGAAGGTCAGGGAAGG - Intronic
1002099824 5:176851841-176851863 TGCCTGGGGAAGAACCCGGATGG + Intronic
1005585464 6:27272648-27272670 GTTGTGGGGAAGGACAGGGATGG + Intergenic
1006135313 6:31892361-31892383 GCCCTGGGGGAGCACCGGCGGGG + Intronic
1006146733 6:31963893-31963915 GTCCTGGAGAAGGAAGGGGAAGG - Exonic
1006440369 6:34050065-34050087 GTCATGGGGGAGCAACGGGCAGG - Intronic
1010186400 6:73148890-73148912 CTCCTAGGGAAGCACTGAGAAGG + Intronic
1014223826 6:118825330-118825352 TTCCTGGGGAAGTGCGGGGATGG - Intronic
1014913079 6:127117433-127117455 GTCTTGGGGAAGGAAGGGGAAGG - Intergenic
1017007442 6:150038095-150038117 GCCCTGGGGATGCTGCGGGAGGG + Intergenic
1017823149 6:158063308-158063330 GTGCTGGGGATCCACTGGGATGG + Intronic
1019073909 6:169371428-169371450 GTCCTGGAGAAGGACGGCGAGGG - Intergenic
1019685675 7:2380632-2380654 GTCCCGGAGACCCACCGGGAGGG + Exonic
1022534163 7:31085492-31085514 GTCCTGGGGAACCAAGGGGATGG - Intronic
1023971933 7:44998273-44998295 GGCCTGGGGAAGCAAGGGGCAGG - Intergenic
1025709264 7:63891927-63891949 GCCCTGGGCAGGCACTGGGAGGG + Intergenic
1029283110 7:99449387-99449409 GCACTGGGGCAGCACTGGGATGG + Intronic
1029361072 7:100089029-100089051 GACCGGAGGAAGCAGCGGGATGG + Exonic
1034066835 7:148145092-148145114 TTCCTGAGGAAGCAACGGAAGGG + Intronic
1034292760 7:149945762-149945784 GTTCTGGGGAAGCACTGGGGAGG + Intergenic
1034426747 7:151018048-151018070 GACCTGGGGAAGCAGCGGTGAGG + Exonic
1034529566 7:151687329-151687351 GTCCTGGGGAGGCACAGGGGAGG + Intronic
1034813307 7:154151110-154151132 GTTCTGGGGAAGCACTGGGGAGG - Intronic
1035113912 7:156506806-156506828 GTCCTGTGGCAGCAGCGGGGCGG + Intergenic
1035220255 7:157402280-157402302 GGACTGTGGAAGCACAGGGAAGG + Intronic
1035657906 8:1324994-1325016 GGCCTGGGGAAGTACAGGGGTGG - Intergenic
1038319497 8:26514139-26514161 GTCAGGGGGAGGGACCGGGAGGG + Intergenic
1040555975 8:48477932-48477954 GTGCTGGGGAGCCAGCGGGAAGG + Intergenic
1041118027 8:54559674-54559696 GGCCTGGGGAAACCCCTGGAGGG + Intergenic
1041196988 8:55410489-55410511 GTCCAGTGGAAGCCCAGGGAAGG - Intronic
1041519675 8:58741255-58741277 GTCCAGGGGAAGGGGCGGGATGG + Intergenic
1044904527 8:96986646-96986668 GGCCTGGGGAAACAGTGGGAGGG + Intronic
1045055572 8:98365050-98365072 GTTGTGGGAATGCACCGGGATGG - Intergenic
1047700293 8:127442776-127442798 GACTTGGGTAAGCACTGGGATGG + Intergenic
1048273842 8:133050913-133050935 GTCCTGGGGAAACAAAGGCAAGG + Exonic
1048838849 8:138547014-138547036 TTCCTGGGGAAGGCCCGGCATGG - Intergenic
1049061510 8:140279688-140279710 GTCCTGCGGATGCACTGTGACGG - Intronic
1049623841 8:143611384-143611406 GTCCTGGGGTGTCAGCGGGAGGG + Intergenic
1053538099 9:38946122-38946144 CACCTGGGGAAGCACCAGGTTGG + Intergenic
1054628035 9:67417799-67417821 CACCTGGGGAAGCACCAGGTTGG - Intergenic
1055250249 9:74294675-74294697 TTACTGGGGAAGCAGAGGGAGGG - Intergenic
1056794444 9:89647970-89647992 GTCCTGTGCAAACACAGGGATGG + Intergenic
1057089857 9:92247448-92247470 GTCCTGGGGAAGCGTCTGAAGGG - Exonic
1059325991 9:113504297-113504319 GCCCTGGTGAGGCACAGGGAAGG - Intronic
1061188773 9:129070099-129070121 GTCCAGAGGAAGCAGTGGGAGGG + Intronic
1061486490 9:130923033-130923055 GTTCCGGGGAAGCACAGAGATGG - Intronic
1061488718 9:130933704-130933726 GTTCTGGGGAAGCGGCGGGCGGG + Intronic
1061779871 9:132989237-132989259 TCCCTGGGGAAGCACAGAGAAGG - Intronic
1062002728 9:134224987-134225009 GCCCAGGGGAAGCCCCTGGATGG + Intergenic
1062260890 9:135662955-135662977 GTGCTGGGGAAGGAGCGGGAGGG + Intergenic
1185649306 X:1637122-1637144 GTCCTCGTGAAGCATCAGGATGG - Intronic
1185649348 X:1637364-1637386 GTCCTCGTGAAGCATCAGGAGGG - Intronic
1185649570 X:1638601-1638623 GTCCTCGTGAAGCATCAGGATGG - Intronic
1185649714 X:1639424-1639446 GTCCTCGTGAAGCATCAGGATGG - Intronic
1189588562 X:42487687-42487709 GTCCTAGAGAACCACCAGGAGGG + Intergenic
1190501448 X:51082675-51082697 GTACTGGGGAAGCAACATGATGG - Intergenic
1193793781 X:85848140-85848162 GTCATGGGGAAGCTAAGGGAGGG + Intergenic
1195051193 X:101098374-101098396 ATCCTTGGGAAGCGCTGGGATGG + Intronic
1198509365 X:137334043-137334065 ATGCTGCGGAAGCACCTGGAAGG - Intergenic
1200000344 X:153056746-153056768 GTCCTGGGGCAGCGCGGGGAGGG + Intronic