ID: 1169355166

View in Genome Browser
Species Human (GRCh38)
Location 20:4899332-4899354
Sequence CAGCTTGGACAACTGGGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169355158_1169355166 14 Left 1169355158 20:4899295-4899317 CCAAGGGGGCAGGGGAAGGAGAG 0: 1
1: 0
2: 5
3: 121
4: 958
Right 1169355166 20:4899332-4899354 CAGCTTGGACAACTGGGTAGGGG 0: 1
1: 0
2: 2
3: 10
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169355166 Original CRISPR CAGCTTGGACAACTGGGTAG GGG Intronic
901500960 1:9652356-9652378 CAGCCTGGGCAAGTGGGGAGCGG + Intronic
901919695 1:12527508-12527530 CAGATTGGACAGCACGGTAGAGG + Intergenic
903215131 1:21839516-21839538 CAGCTTGGACCAGTGGATGGTGG + Exonic
908022009 1:59907783-59907805 CACCTTGGATTTCTGGGTAGAGG + Exonic
912630446 1:111242316-111242338 CTGCTTGGACAAGAGGGTAAGGG - Exonic
912755480 1:112321478-112321500 TAGCTTGGACAAGTGGGTAAAGG + Intergenic
914393714 1:147244327-147244349 CAACTTGGATAAATTGGTAGTGG + Intronic
915885141 1:159713847-159713869 CAGCTTGTACAAATGTGTACTGG + Exonic
917874682 1:179275397-179275419 CAGCTTGGAGAACTGGCATGAGG - Intergenic
919542552 1:198868628-198868650 TAGTTTGGATATCTGGGTAGGGG - Intergenic
919554585 1:199034846-199034868 CAACTTGGACAACTCCGTGGAGG - Intergenic
920457146 1:206110022-206110044 CAGCTGTGACACCAGGGTAGGGG + Exonic
922664416 1:227456415-227456437 CAGATTGGAAAAATGGGCAGGGG - Intergenic
1063218637 10:3945844-3945866 CAGCTTTGACTACTGGCTGGGGG - Intergenic
1064778268 10:18804574-18804596 CAACTGGGACAACTGAGTATGGG + Intergenic
1067730094 10:48804423-48804445 CAGCCGGGACTTCTGGGTAGAGG + Intronic
1068137112 10:52961613-52961635 CAGCTTGGTCAGCTGCGTGGAGG - Intergenic
1069849282 10:71394814-71394836 CAGATTTGACCTCTGGGTAGCGG + Intergenic
1070574129 10:77664623-77664645 CAGCTGGGAAATCTGGGGAGAGG - Intergenic
1070833152 10:79432403-79432425 CAGCAGGGACAAAAGGGTAGAGG + Intronic
1072058435 10:91784243-91784265 CAGCTTGGGCAACAGAGTAAGGG + Intergenic
1075321345 10:121493888-121493910 CAGCTTGAAAAACTGGATGGTGG - Intronic
1075747446 10:124737558-124737580 CACCTTTGACAACTGGCTACGGG + Intronic
1076248229 10:128964196-128964218 CAGCGTGGCCAACTGGGTAGAGG + Intergenic
1077619896 11:3711474-3711496 CAGCTGGGCCAACTGGAAAGAGG + Intronic
1079242262 11:18729292-18729314 TAGCGAGGACAGCTGGGTAGAGG - Intronic
1082762542 11:57141724-57141746 GAGCTTGTGCAACTGGGTGGAGG + Intergenic
1084025632 11:66447118-66447140 GAGCCTGGACAGGTGGGTAGGGG + Intronic
1085321405 11:75576360-75576382 CAGCATGGGCAAATGGGAAGGGG - Intergenic
1085819433 11:79776544-79776566 GAGCTTGGACATGTGGGTGGAGG + Intergenic
1085914533 11:80869519-80869541 CAGCCTGTATAACTGGGCAGAGG - Intergenic
1088921929 11:114265813-114265835 CAGATTGGACAACTAAGTTGAGG - Intronic
1091991493 12:4959693-4959715 GAGCTTGGACATCTGGGCAGTGG - Intergenic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1099291040 12:80776878-80776900 CACCTTGAAAAACTGGGAAGAGG - Intergenic
1099739366 12:86612092-86612114 CTGATTGGACAAATAGGTAGAGG - Intronic
1101186318 12:102284338-102284360 CAGATTAGACAGATGGGTAGGGG + Intergenic
1103135756 12:118506163-118506185 CAGCTTGGAAATCTGGATGGTGG + Intergenic
1103964597 12:124630723-124630745 CAGCGTGGGCATTTGGGTAGAGG - Intergenic
1104598304 12:130134673-130134695 CAGCAGGGATAGCTGGGTAGTGG - Intergenic
1105489325 13:20872289-20872311 GTGCTTGGACAACTGGGGAAAGG - Intronic
1106212851 13:27666927-27666949 CACTTTGGAAAACTGGGGAGGGG - Intronic
1107266175 13:38557960-38557982 CAACTTGGACATCTGGATAAGGG + Intergenic
1107688180 13:42925132-42925154 CAGCTAGGACAGCGGGGGAGAGG - Intronic
1107706845 13:43116380-43116402 CGGCTTGGAGAGCTGGGTCGTGG - Intergenic
1108150824 13:47531897-47531919 CAGCTAGCAGAACTGGGGAGGGG + Intergenic
1110775483 13:79404520-79404542 CAAGTTGGACAAGTAGGTAGGGG - Intronic
1115121733 14:29944682-29944704 CATCTTTGACATCTAGGTAGTGG - Intronic
1115694421 14:35881311-35881333 CAGCTTGGAGGCCTGGGTGGTGG - Intronic
1117539164 14:56729924-56729946 CATTTTGGACAACTGGGCAGGGG - Intronic
1118952215 14:70445362-70445384 CAGCCTGGAAAACTGGTCAGTGG - Intergenic
1119655311 14:76413268-76413290 CAGCATGGACAGGTGGGCAGAGG - Intronic
1122055356 14:99094375-99094397 CGGCTTGGACAGCTGGACAGAGG - Intergenic
1124508644 15:30303583-30303605 CAGCTTGAGCACCTGGGAAGAGG - Intergenic
1124734913 15:32235078-32235100 CAGCTTGAGCACCTGGGAAGAGG + Intergenic
1125722041 15:41849849-41849871 CAGGTGGGACACCTGGGTGGGGG - Exonic
1126178179 15:45758156-45758178 CAGCCTGCAAAACTGGGCAGAGG - Intergenic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129651135 15:77490691-77490713 TGGCTTGGAAAACTGGGTAATGG + Intergenic
1129794165 15:78363352-78363374 CAACCTGCACCACTGGGTAGTGG + Intergenic
1129940691 15:79494513-79494535 GAGCTTGCACAGCTGGGGAGTGG + Intergenic
1130053793 15:80505722-80505744 TAGTTTGAGCAACTGGGTAGTGG + Intronic
1131294902 15:91139202-91139224 GAGGTTGGAGAACTGGGTAGGGG + Intronic
1133371827 16:5251091-5251113 CTGCGGGGACAAGTGGGTAGGGG - Intergenic
1135546610 16:23371218-23371240 GAGCTTGGAGAAGTGGGTAGTGG + Intronic
1136182299 16:28562032-28562054 GAGCTTTGCCTACTGGGTAGTGG - Intronic
1137478443 16:48830891-48830913 CAGCATGGACACCTGGGTTCAGG + Intergenic
1141244259 16:82291597-82291619 CAGCCTGGACAACTGTGTTAGGG - Intergenic
1144774748 17:17779698-17779720 TAGCCTGGCCAAGTGGGTAGCGG + Intronic
1146437035 17:32859783-32859805 TAGCTTGTAAAACTGTGTAGAGG + Intronic
1147012644 17:37463677-37463699 CAGCCTGGACAACTGGAGTGAGG - Intronic
1147956366 17:44137614-44137636 TGACTTGGACAACTGGGTAGTGG - Intergenic
1148742922 17:49902870-49902892 CAGCCTGGGCAACTGGGCAACGG + Intergenic
1150650748 17:67008517-67008539 CAGCTTGGAGCACTGGCTGGTGG + Intronic
1152053491 17:78001549-78001571 CAGATTGGACATCTCAGTAGGGG + Intergenic
1156453342 18:37279088-37279110 CAGCTTAGGCAGCTGGGCAGTGG - Intronic
1157280724 18:46344899-46344921 CATCTTGGACACCAGGGTGGTGG + Intronic
1159570082 18:70102959-70102981 CAGACTGGACAGCTGGGCAGAGG - Intronic
1161298901 19:3533346-3533368 CAGCTTGGCCACCTGGGTCAGGG - Exonic
1162909348 19:13841056-13841078 CACCTTGGAAAGCTGGGTGGGGG - Intergenic
1164933528 19:32193957-32193979 CAGCTTGGACCAGGGGGCAGTGG + Intergenic
1166103014 19:40582493-40582515 CAGTCTGGAAAACTGGGAAGGGG - Intronic
1166392995 19:42420530-42420552 CAGCTTGAGCAAATGGGGAGAGG - Intronic
1166794393 19:45417595-45417617 GGGCCTGGAGAACTGGGTAGAGG + Intronic
1167397007 19:49236356-49236378 CAGCTTGGACCACTCAGGAGAGG - Intergenic
925330308 2:3053440-3053462 CAGCATGAACATCTGGGGAGTGG + Intergenic
927511114 2:23644327-23644349 CAACTCTGACAACTGGGCAGCGG + Intronic
928099536 2:28427969-28427991 AAGCTTGGACAACTGGACATTGG + Intergenic
928225754 2:29446606-29446628 CAGCTTGGAGATCTTGGCAGTGG - Intronic
929016414 2:37501556-37501578 CAGCTTGGAGAAGTGGGATGTGG - Intergenic
934049407 2:88197913-88197935 CAGCCTGGACCCCTGGGAAGAGG - Intergenic
936399734 2:112156111-112156133 CAGGTTGGGCACCTGGGCAGCGG - Intronic
937262786 2:120597097-120597119 CAGCTTGGAAATCTGGCTCGAGG + Intergenic
937392716 2:121504847-121504869 CAGCTTTAACGAATGGGTAGTGG - Intronic
941407521 2:165109515-165109537 CACCGTGAACAAATGGGTAGAGG - Intronic
947551196 2:231047989-231048011 GGGCTTGGACTACTGGGTATAGG + Exonic
947983259 2:234427522-234427544 CAGCTTTGAGAAATGGGGAGGGG - Intergenic
948519888 2:238529335-238529357 CAGCCTGGACACCTGGGAAAGGG + Intergenic
1169355166 20:4899332-4899354 CAGCTTGGACAACTGGGTAGGGG + Intronic
1170625940 20:18030252-18030274 CCGCTTGATCTACTGGGTAGTGG - Intronic
1170737684 20:19025728-19025750 CATCAGGGACAACTGGGAAGTGG - Intergenic
1170873722 20:20231788-20231810 CAGCTTGTACTATGGGGTAGAGG + Intronic
1172091814 20:32437988-32438010 CTGCTTGGACAATGGGGTTGGGG + Exonic
1174642957 20:52061120-52061142 CAGCTTGTAAAGCTGGGTGGGGG + Intronic
1175942851 20:62545947-62545969 CAGCTTCCTCAACTGGGAAGGGG - Intergenic
1176035358 20:63033767-63033789 CATCTTGGAGAACAGGGCAGGGG - Intergenic
1176068866 20:63215859-63215881 CAGCGTGGACACCCAGGTAGCGG - Exonic
1176698212 21:10007052-10007074 GTGCTGGGAAAACTGGGTAGTGG - Intergenic
1177797912 21:25798453-25798475 CACCTTAGACTCCTGGGTAGCGG + Intergenic
1178240570 21:30894895-30894917 CAGCTTGGACAACTTCACAGTGG - Intergenic
1179006802 21:37522424-37522446 CAGCGTGGAGAACTGGAAAGAGG - Intergenic
1179973567 21:44849996-44850018 CAGCCTGAAGAACTGGGTACAGG + Exonic
1185151247 22:49164900-49164922 CAGCTGGGGCATCTGGGGAGAGG - Intergenic
950579063 3:13850945-13850967 CAGCCTGGGCAAATGGGTACTGG - Intronic
950581121 3:13862704-13862726 CAGCTCGGGAAACTGGGGAGGGG + Intronic
951170279 3:19533763-19533785 CTTCTTGGACAACCTGGTAGTGG - Exonic
954326747 3:49868225-49868247 CAGCTGGGCCAACTGAGAAGAGG - Intronic
954414311 3:50385476-50385498 CAGCTTGGTCAAATGCCTAGAGG - Intronic
960942294 3:122943022-122943044 CACCTGGGACGGCTGGGTAGGGG - Intronic
961102729 3:124215225-124215247 CATCTGGGGCACCTGGGTAGGGG + Intronic
961422216 3:126815461-126815483 CAGCTTAGACAACGAGGTGGAGG - Intronic
963702200 3:148640520-148640542 CAGCTTACACATCTGGTTAGTGG + Intergenic
966315741 3:178643827-178643849 CAGCTCTGAGAACTGGGAAGTGG - Intronic
966854859 3:184186840-184186862 TATCTTTGACAACTGGATAGGGG - Exonic
973020134 4:45194170-45194192 AAGTTTGTAGAACTGGGTAGTGG - Intergenic
973677977 4:53285945-53285967 CAGCTTGGGCCACGGGGTTGTGG - Intronic
976281395 4:83330281-83330303 TAGCTTGGACAAGGAGGTAGAGG + Intronic
980113231 4:128654438-128654460 TAGGCTGGAGAACTGGGTAGGGG + Intergenic
982358120 4:154491149-154491171 GAGGTTGAACAACTGGGCAGAGG + Intronic
983246321 4:165291856-165291878 CAGCCTGGGCAACTGGGTAACGG - Intronic
986163954 5:5257263-5257285 AAGCTTGGACAAGTTAGTAGTGG - Intronic
988278607 5:29114776-29114798 CAGCCAGGAAAACTGGGGAGGGG - Intergenic
989467739 5:41776327-41776349 GATCTTGGAAAACTGGGTGGGGG + Intronic
992203791 5:74410000-74410022 CAGGTTGGAGAACAGGGAAGAGG + Intergenic
997308972 5:132864103-132864125 CAGATTGGTTAACTGGGTGGAGG - Intronic
999770626 5:154773035-154773057 CTGTTGGGACAACTGGGAAGAGG + Intronic
1002108886 5:176894610-176894632 CAGGTTGGACAAGGGGGAAGTGG + Intronic
1003241321 6:4347993-4348015 CAGCATGGAGAAATGGGCAGAGG + Intergenic
1004119765 6:12809462-12809484 CAGTTTGGATAAATGGATAGTGG - Intronic
1004173896 6:13322040-13322062 CAGCCTGGGCAACTGGGTGAAGG + Intronic
1004472221 6:15939523-15939545 CAGATGGGAAAACTGAGTAGGGG - Intergenic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1005436101 6:25813729-25813751 CACCTTCTACCACTGGGTAGAGG - Intronic
1006381177 6:33698195-33698217 CAGGTTGCACAGCTGGGAAGTGG + Intronic
1007991644 6:46262212-46262234 CTGCTTAAGCAACTGGGTAGAGG - Intronic
1016287189 6:142486389-142486411 CAGATTGCACAACTGGTAAGTGG - Intergenic
1016409461 6:143766697-143766719 CAGCTTGGGCAACTGGGTGGTGG - Intronic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1019685439 7:2379419-2379441 CAACGTGGACGACTGGGAAGAGG + Exonic
1023110582 7:36806974-36806996 CAGATTGAAAAACTGGGAAGAGG - Intergenic
1023581655 7:41690357-41690379 CAGCTTGGACACAGGGGAAGAGG - Exonic
1025190057 7:56889488-56889510 CAGCTTGGAAACCTGGCTGGGGG + Intergenic
1025681883 7:63687433-63687455 CAGCTTGGAAACCTGGCTGGGGG - Intergenic
1026957919 7:74389433-74389455 CTGCTTGGAAAACAGTGTAGAGG - Intronic
1029117383 7:98244318-98244340 CAGCTTGGACACCAGGGTCAGGG + Intronic
1029992235 7:104973158-104973180 CAGCCTGGACAACAGAGGAGAGG + Intergenic
1030724521 7:112910237-112910259 CAGTTAGGACAACGGGGTTGTGG - Intronic
1035226688 7:157437844-157437866 CAGGCTGGACAACTGGGTGGGGG - Intergenic
1039329741 8:36524014-36524036 CAGCTTGGTTAACAGGGTGGGGG + Intergenic
1039793703 8:40895169-40895191 CAGTTTGGCCAATTGGGAAGAGG + Intronic
1041423267 8:57692961-57692983 CAGCCTTGACAAGTGGGAAGTGG + Intergenic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1043064139 8:75544860-75544882 CAGATTGGACATTTGGGAAGAGG + Intronic
1048218984 8:132524341-132524363 TAGCTTGGATAAGTTGGTAGGGG + Intergenic
1049314145 8:141950880-141950902 CAGCTTTGCCAAATGGGAAGGGG + Intergenic
1049619318 8:143590876-143590898 CAGCCTGGACAACAGAGCAGGGG + Intronic
1051604871 9:18909029-18909051 CAGTTAGGACAAATGGGGAGGGG + Exonic
1052158574 9:25226467-25226489 CAGCTCGGGGAACAGGGTAGGGG + Intergenic
1052169856 9:25379727-25379749 CACCTTGGACAGCTTGGTAAAGG + Intergenic
1052835441 9:33246647-33246669 CAGGTTGGACATCTGGGAACAGG - Exonic
1054316265 9:63590838-63590860 GTGCTGGGAAAACTGGGTAGTGG - Intergenic
1056958483 9:91101515-91101537 CATCTGGGACAACTGGGCAGGGG - Intergenic
1057176605 9:93004788-93004810 CAGCTTGGAGAACGGGCTGGTGG - Intronic
1058646811 9:107138675-107138697 CAGCTTGCACAACTGATCAGAGG - Intergenic
1061622622 9:131821510-131821532 CAGCTTGGGCACCTGGGAGGGGG - Intergenic
1187063398 X:15809617-15809639 CATGGTGGACAACTGGGTTGGGG + Intronic
1188102872 X:26112182-26112204 CAGCCTGGACAACTCAGTTGTGG + Intergenic
1192747294 X:73951691-73951713 CAGCCTGGGCAACTGGGTGAGGG + Intergenic
1195481909 X:105354926-105354948 CAGCTTGAGCAATTGGGTAGAGG - Intronic
1195616472 X:106916432-106916454 CAGTTTGGAGAGCTAGGTAGGGG + Intronic
1196067739 X:111483704-111483726 CAGGTTAGACAGCAGGGTAGGGG - Intergenic
1199318278 X:146406914-146406936 AAGATTGCACAACTGGGTACTGG + Intergenic