ID: 1169355821

View in Genome Browser
Species Human (GRCh38)
Location 20:4904169-4904191
Sequence TGTCAGCTTGACCTCTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 6, 2: 22, 3: 64, 4: 246}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169355814_1169355821 27 Left 1169355814 20:4904119-4904141 CCTCTTCTCTAGTTTATACATAT 0: 1
1: 0
2: 3
3: 35
4: 399
Right 1169355821 20:4904169-4904191 TGTCAGCTTGACCTCTGGAGGGG 0: 1
1: 6
2: 22
3: 64
4: 246
1169355816_1169355821 -3 Left 1169355816 20:4904149-4904171 CCTGAAACTTGGCCACACAGTGT 0: 1
1: 0
2: 1
3: 5
4: 165
Right 1169355821 20:4904169-4904191 TGTCAGCTTGACCTCTGGAGGGG 0: 1
1: 6
2: 22
3: 64
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169355821 Original CRISPR TGTCAGCTTGACCTCTGGAG GGG Intronic
900288048 1:1911151-1911173 TGTCAGCTCTTCCTATGGAGTGG + Intergenic
900764029 1:4491943-4491965 TATCAGTTTGACCTCTGGAGAGG + Intergenic
900796867 1:4713188-4713210 TGCCAACTTGACCTCGGTAGAGG + Intronic
902261289 1:15226649-15226671 TGACAGTTTGCCCTCTGGGGTGG + Intergenic
902927622 1:19707182-19707204 TTTCAGCATGAAATCTGGAGGGG - Intronic
903123659 1:21233302-21233324 GGTGAGCCTGGCCTCTGGAGCGG - Intronic
903396890 1:23008354-23008376 TGAAAGCTAGATCTCTGGAGAGG - Intergenic
903988784 1:27250026-27250048 TGTCAGCTTCATCTCTGGTAGGG + Intronic
904256108 1:29255923-29255945 TGTCATCCTGAGCTCTGGACTGG + Intronic
904596294 1:31648017-31648039 TCCCACCTTGGCCTCTGGAGTGG - Intergenic
905853368 1:41290674-41290696 TGTCAGCTGGAACCCTGGTGGGG + Intergenic
909756255 1:79229853-79229875 CATCTGCTTGGCCTCTGGAGAGG + Intergenic
910740765 1:90513745-90513767 TGTCTGCTTGGCTTCTGGGGAGG - Intergenic
911523907 1:98961382-98961404 TCTCAGCTTGACCTCAACAGAGG + Intronic
912345181 1:108957090-108957112 TGTCACCTTCATCTCTGAAGTGG - Intronic
912996317 1:114535691-114535713 TGTCAGCTCAACCTCAGGAGGGG + Intergenic
915056165 1:153133372-153133394 TGTGAGATTCATCTCTGGAGTGG - Intergenic
915718838 1:157968714-157968736 TGTCTGTTTGGCCTCTGGGGAGG - Intergenic
915920256 1:159971103-159971125 TGTCAGCCTGACCTTTGGAAGGG - Intergenic
918073148 1:181148629-181148651 TATCAGCCTGACCTCTGGGAAGG - Intergenic
918383672 1:183983889-183983911 GGACAGCTGGACATCTGGAGAGG + Intronic
920063343 1:203244955-203244977 TATCAATTTGACCTCTGTAGCGG - Intronic
920276999 1:204813848-204813870 TGTCAGTTTGGTTTCTGGAGGGG + Intergenic
920308319 1:205032893-205032915 GGTGAGCTTGACCCCGGGAGGGG - Intergenic
920564794 1:206964648-206964670 TATCTGCTTGACTTCTGGTGAGG - Intronic
920646620 1:207808398-207808420 TTTCAGCTTGACCCGAGGAGTGG - Intergenic
921817979 1:219585914-219585936 TGGCTGCTTCACCACTGGAGGGG + Intergenic
922327567 1:224543083-224543105 TATCAGCCGGATCTCTGGAGAGG + Intronic
923892066 1:238227013-238227035 TAACAGCTTGACCTCTAGAGGGG + Intergenic
924278094 1:242408620-242408642 TGTCTGCTTGGCTTCTGGTGAGG - Intronic
924631131 1:245741833-245741855 TGTCAAATTCACCTCTCGAGGGG - Intergenic
924951954 1:248892799-248892821 TACCAGCTTGACCTTTGGATGGG + Intergenic
1070334746 10:75445430-75445452 TGTCAGATTACCCTCTGGAGAGG + Intronic
1071484194 10:86087547-86087569 TGTCAGTTTTCACTCTGGAGGGG - Intronic
1074036593 10:109745361-109745383 TGCCAGCGTGGCCTCTGAAGTGG + Intergenic
1075097895 10:119484699-119484721 TATCAGTTTAACCTCTGGAGGGG + Intergenic
1076482622 10:130794726-130794748 TGTCAACTTGGCCCATGGAGTGG - Intergenic
1077211804 11:1374646-1374668 TGTCTGCTTGGCTTCTGGGGAGG - Intergenic
1078985137 11:16586607-16586629 TCTCACCTTGTCCTCTGGAGTGG - Intronic
1081765614 11:45608090-45608112 TTGCAGCATGACCTCTGGAAGGG - Intergenic
1084439597 11:69165018-69165040 TCTCCTTTTGACCTCTGGAGGGG + Intergenic
1085006207 11:73093012-73093034 TATCATCTCAACCTCTGGAGAGG + Intronic
1085714781 11:78862805-78862827 TGGCAGCTTGACAGCTGGCGTGG + Intronic
1087337789 11:96866190-96866212 TGACAGCTGGGTCTCTGGAGGGG - Intergenic
1088792331 11:113236821-113236843 TGTCAGCTTGGTAGCTGGAGGGG + Intronic
1089117906 11:116111199-116111221 TCTCAGATTGACCTCTGGAGGGG + Intergenic
1089198529 11:116709656-116709678 TGTCTGCGTGACCTCAGGACTGG + Intergenic
1089213582 11:116822232-116822254 TGTCTTCTTGACCTCTGCTGGGG + Intronic
1089513887 11:119019123-119019145 CGTTAGCTTCACCTCTGCAGTGG + Exonic
1090877996 11:130808023-130808045 TTTCAGCATGAATTCTGGAGAGG + Intergenic
1093239449 12:16651983-16652005 TATCTGCTTGACTTCTGGGGAGG + Intergenic
1094174236 12:27525000-27525022 TGCCAGCTTTATATCTGGAGAGG + Intronic
1094262484 12:28516907-28516929 TTTCAACTTGACTTTTGGAGGGG + Intronic
1094296490 12:28912895-28912917 TGGCAGCTTCATTTCTGGAGTGG - Intergenic
1094419248 12:30253380-30253402 TACCAGCTTGACCTCTGGAGGGG + Intergenic
1094428847 12:30344339-30344361 TATCAGCTTGATCTCTGGAAGGG - Intergenic
1095051403 12:37557786-37557808 TGTCAGCTTGACCTTGGGAAGGG + Intergenic
1095054726 12:37585388-37585410 TGTCAGCTTGACCTTGGGAAGGG + Intergenic
1095568708 12:43657088-43657110 TATCAGTTTGACCTCTGGGAGGG + Intergenic
1096357605 12:50954881-50954903 TGTGAGCATGAACTTTGGAGTGG + Intronic
1096972626 12:55680010-55680032 TATCTGCTTGGCCTCTGGTGAGG - Intergenic
1097514766 12:60591368-60591390 TATTAGATTAACCTCTGGAGAGG + Intergenic
1098169254 12:67729684-67729706 TTTCAGCTTGAATTTTGGAGGGG + Intergenic
1099629132 12:85117562-85117584 TGACACCTTGATCTCTAGAGTGG - Intronic
1099698082 12:86046253-86046275 AGTCAGCTTGAACTCATGAGTGG - Intronic
1103860353 12:124007369-124007391 TGGCAGCTTGATTCCTGGAGGGG + Intronic
1105230340 13:18488911-18488933 TGTGAGCATAAGCTCTGGAGAGG + Intergenic
1105604710 13:21917364-21917386 TGACCCCTTGACCTCTGGGGAGG + Intergenic
1105664876 13:22542808-22542830 TGTCACCTTGACTTCTAGATGGG + Intergenic
1106383856 13:29265633-29265655 TATCAGCTTAGCTTCTGGAGAGG + Intronic
1107700068 13:43038403-43038425 TTTCAGCTTTTCCTCTGGATGGG - Intronic
1108256423 13:48616044-48616066 TATCAACTTGATCTCTGGAGAGG - Intergenic
1108316276 13:49240774-49240796 TCTCACCTTAGCCTCTGGAGTGG + Intergenic
1110433255 13:75450738-75450760 TATCAGCCTGACCTTTGGGGAGG - Intronic
1111229932 13:85331308-85331330 TAATATCTTGACCTCTGGAGGGG - Intergenic
1111619890 13:90711342-90711364 TGTCAGATTGTACTCTGGATTGG - Intergenic
1111740951 13:92205369-92205391 CATCAGCTTGACCTCCAGAGAGG - Intronic
1111935192 13:94550198-94550220 CGTCAGACTGGCCTCTGGAGAGG + Intergenic
1112107108 13:96252878-96252900 CATCTGCTTGACTTCTGGAGAGG - Intronic
1112111300 13:96302125-96302147 TGTCAGGTTGCCCTCCTGAGAGG - Intronic
1112304566 13:98261919-98261941 TTTCAGCATGAGATCTGGAGGGG + Intronic
1112996913 13:105585663-105585685 AGTCAGCTTGACCTATGCAGAGG - Intergenic
1113701580 13:112392704-112392726 TGTCGTCTTGACCTCTCAAGGGG + Intronic
1114431022 14:22660637-22660659 TTTCAGCTTGAATTTTGGAGGGG + Intergenic
1114596619 14:23917697-23917719 GCTCAGCCTGACCTCTGGAGAGG + Intergenic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1116275817 14:42829839-42829861 TGTCAGCCTGGCCTCTGGAGTGG - Intergenic
1117121811 14:52576045-52576067 TATCAGTTTGACTTCTGGAGAGG - Intronic
1117209406 14:53480472-53480494 TGTCTGCTTGCCCTTTGGTGAGG + Intergenic
1119251765 14:73161753-73161775 TATCAGCTTGGCCTCTGAAGGGG - Intronic
1120754423 14:88228954-88228976 TGTCAGCTTGACCATTCTAGAGG - Intronic
1121139117 14:91525398-91525420 TTTCTGCTTGACTTCTGGGGAGG + Intergenic
1121427584 14:93863590-93863612 TGTCTGTTTGACCTCTGAAGGGG - Intergenic
1123027432 14:105433361-105433383 CATCAGCCTGACCTCTGGAGGGG - Intronic
1124176035 15:27424952-27424974 TATCAGCTTGACCTCTGGAGGGG + Intronic
1125907097 15:43402953-43402975 TTTCAGCCAGCCCTCTGGAGTGG - Intronic
1127707962 15:61565995-61566017 CATCTGCTTGACTTCTGGAGAGG + Intergenic
1128356838 15:66934052-66934074 CATCAGCCTGACCTCTGGGGAGG - Intergenic
1129614893 15:77090638-77090660 TGGCTGCTTCACCTTTGGAGAGG + Intergenic
1129928037 15:79383721-79383743 CATCAGCTTTATCTCTGGAGGGG - Intronic
1130690321 15:86076685-86076707 TATAAGCTTGACCTCTGGCAGGG + Intergenic
1132359902 15:101203286-101203308 TGTGGCCTTGACCTGTGGAGTGG - Intronic
1134113996 16:11534409-11534431 TACCAGCATGACCTCTGGAGGGG + Intergenic
1134570084 16:15283508-15283530 TGTCAGTTTGACCTCTAGAGGGG - Intergenic
1134732292 16:16472541-16472563 TGTCAGTTTGACCTCTAGAGGGG + Intergenic
1134935144 16:18239422-18239444 TGTCAGTTTGACCTCTAGAGGGG - Intergenic
1135473730 16:22755072-22755094 TGGTAGCTTAACCTCTGAAGTGG - Intergenic
1135704574 16:24663780-24663802 TATCAGCCTGACCTCTGGAGGGG - Intergenic
1136272489 16:29156721-29156743 TGTCACCTCCACCTCTGCAGAGG + Intergenic
1138245032 16:55461023-55461045 CCTCAGCTTGTCCTCTGGAGTGG - Intronic
1138375110 16:56557920-56557942 TTTGAGCTTGCCCTCTGGATGGG - Intergenic
1138657912 16:58501329-58501351 TGTGACCTTGAGCACTGGAGGGG - Intronic
1138723109 16:59105024-59105046 TGTCTGCTTGGCTTCTGGGGAGG - Intergenic
1139485748 16:67255713-67255735 TGTCAGCATGACCCCTGGCCCGG - Intronic
1140125062 16:72111864-72111886 TATCAGCCTCACCTCTGGGGAGG - Intronic
1141093819 16:81148598-81148620 TGTCAGCTTGACCTCTAGAGGGG + Intergenic
1141247135 16:82318408-82318430 TGTCAGCTTGACTTCTGCAGGGG + Intergenic
1142435455 16:90053921-90053943 TCTCTGCTTGGCTTCTGGAGAGG - Intergenic
1142928537 17:3262059-3262081 TGTCATTGTGACCTCTGGGGTGG + Intergenic
1144317549 17:14077380-14077402 TGTCAACTTGAGTTCTGGAATGG + Intronic
1145372034 17:22314671-22314693 TGTCAGCTTGACCTTGGGAAGGG + Intergenic
1145375399 17:22342864-22342886 TGTCAGCTTGACCTTGGGAAGGG + Intergenic
1145854093 17:28135403-28135425 TATTAGTTTGACCTCTGGAGGGG - Intronic
1146282878 17:31557045-31557067 TCCCAGCTTGACTTCTGGAAGGG - Intergenic
1147478232 17:40734346-40734368 TATCAGTTTGACTTCTGGAGGGG + Intergenic
1149467036 17:56888172-56888194 AGTCAGCCTGACCTATGGGGCGG - Exonic
1149523356 17:57335211-57335233 TGTTAGCTTTTCCTCTGAAGTGG + Intronic
1149592270 17:57839283-57839305 AGTCAGCTTGGCCTCTCAAGTGG + Exonic
1149662215 17:58340002-58340024 GGTCAGCTTGACTTCAGGAGCGG - Intergenic
1149713147 17:58761218-58761240 TATCAGCCTAACCTCTGGAGAGG - Intronic
1150264608 17:63824223-63824245 TGCCAGCCTCAGCTCTGGAGAGG - Exonic
1151358490 17:73574075-73574097 TGTCTGCCTGACCTCAGGAATGG + Intronic
1151880689 17:76892854-76892876 CCTCAGCTTGATCTCTGGAAGGG - Intronic
1152305838 17:79519703-79519725 TGTCAGCTTGACCCTTGGAGTGG + Intergenic
1152348467 17:79769430-79769452 TCTGATCTTGCCCTCTGGAGAGG + Intergenic
1153062739 18:1011010-1011032 AGACAGCTTGACCTCAGGCGTGG + Intergenic
1154523062 18:15250959-15250981 TGTGAGCATAAGCTCTGGAGAGG - Intergenic
1155328893 18:24694107-24694129 TATCATCTCGACCTCTGGAGAGG + Intergenic
1156460240 18:37317667-37317689 TGCCAGCCTTGCCTCTGGAGGGG - Intronic
1156530796 18:37813299-37813321 TGTCAACTTGACCTATGGTAAGG + Intergenic
1157468384 18:47968123-47968145 TATCAGCTCCACCTCTGGAGGGG - Intergenic
1157780365 18:50432960-50432982 TATCAACTTGACCTCTGGAAGGG + Intergenic
1158423005 18:57312807-57312829 TGGCACCATGACCTCTGGAGTGG + Intergenic
1158588000 18:58757557-58757579 TATCAGCTTGACCTCTGCAGGGG - Intergenic
1158629366 18:59098971-59098993 TATCAGCTTGACCTTGGGAAGGG + Intergenic
1163101494 19:15099944-15099966 TGTCAGTTTGACCTCTCGAGGGG - Intergenic
1163490937 19:17616845-17616867 TGGCGGCTTGAACTCAGGAGGGG - Intronic
1164414258 19:28033156-28033178 TGTTAGCTTGACCTCTGCCCAGG - Intergenic
1165336394 19:35173053-35173075 TATCAGCTCCACCCCTGGAGGGG - Intergenic
1165572773 19:36789647-36789669 TGTCAGCTTGACCTTGGGAAGGG - Intergenic
1165604838 19:37093081-37093103 TGTCTGCTTGGCTTCTGGTGAGG + Exonic
1165683722 19:37799800-37799822 TGTCAGCTTGACCTTGGGAAGGG - Intronic
1165709614 19:38001131-38001153 TGTGAGCTTGGCTTCTGGGGAGG + Intronic
1166814139 19:45532073-45532095 TATCAGCTTAACCTCTGGAGGGG + Intronic
1167514187 19:49913449-49913471 TATCAGCACGACCTCTGGAGGGG + Intronic
1167535690 19:50050007-50050029 TTCCAGCTTGACTTCTGGAAGGG + Intronic
1167734022 19:51280572-51280594 CATCAGCTTGACCTCTGGAGGGG - Intergenic
1168161382 19:54512679-54512701 TGGCAGCTTGACCTTAGCAGAGG + Intergenic
1168703824 19:58456818-58456840 TGTCAGCTGGAACTCTGGTGGGG + Exonic
925009694 2:473814-473836 TATCAACTTGGCCTCTGGGGAGG + Intergenic
928660843 2:33500428-33500450 TGACAGCTTGAACCCAGGAGAGG + Intronic
929651947 2:43688958-43688980 TATCAGTTTGACCTCTGGGTGGG - Intronic
931788613 2:65643641-65643663 TTCCAGGTTCACCTCTGGAGTGG + Intergenic
933532879 2:83532876-83532898 TGTTAGCTTGATCTCCTGAGAGG + Intergenic
935265577 2:101390899-101390921 TCTCTCCTTGGCCTCTGGAGTGG + Intergenic
937250850 2:120522805-120522827 TGTGACCCTGACCTCTGGGGTGG + Intergenic
937266481 2:120617916-120617938 TGTCTGCCTGACATCTGCAGAGG - Intergenic
937334502 2:121053739-121053761 TCTCAGCATGAAATCTGGAGGGG - Intergenic
937980341 2:127611076-127611098 TGAAAGCTTGACAGCTGGAGGGG + Intronic
938139713 2:128785504-128785526 TGTCAGCCTCACACCTGGAGAGG - Intergenic
938522356 2:132083802-132083824 TGTGAGCATAAGCTCTGGAGAGG - Intergenic
938676196 2:133636931-133636953 TATCAGCTTCACCTCTGGTTAGG + Intergenic
939811608 2:146839630-146839652 TATCAGTTTGACCTCTGGAGAGG + Intergenic
943025030 2:182617184-182617206 TATCAACTTGACCTCTGAAGGGG + Intergenic
945425889 2:209701146-209701168 TGTCAAATTGCCCTCTGGAAAGG + Intronic
1169147649 20:3263968-3263990 TGTCCTCTTCTCCTCTGGAGAGG + Intronic
1169355821 20:4904169-4904191 TGTCAGCTTGACCTCTGGAGGGG + Intronic
1169484200 20:6012965-6012987 TATGAGCCTCACCTCTGGAGGGG + Intronic
1170749775 20:19135310-19135332 TATCAATTTGATCTCTGGAGGGG - Intergenic
1171527532 20:25826917-25826939 TGTCAGCTTGACCTTGGGAAGGG - Intronic
1171545932 20:26001301-26001323 TGTCAGCTTGACCTTGGGAAGGG + Intergenic
1171549294 20:26028967-26028989 TGTCAGCTTGACCTTGGGAAGGG + Intergenic
1172882785 20:38212718-38212740 TGCGAGCGAGACCTCTGGAGGGG + Exonic
1174171773 20:48622032-48622054 TGTCAGCTGGAGCTGAGGAGCGG - Intergenic
1174918592 20:54678554-54678576 TGTCAGAATGACCTCAGGTGTGG + Intergenic
1175020783 20:55846626-55846648 TGCCAGCCTGGCCTCTGGGGAGG - Intergenic
1176774327 21:13117256-13117278 TGTGAGCATAAGCTCTGGAGAGG + Intergenic
1178125660 21:29512982-29513004 TATCAGCTTGACCTCTGGAGGGG + Intronic
1178384094 21:32135310-32135332 TGTAACCTGGCCCTCTGGAGAGG + Intergenic
1178810751 21:35878948-35878970 TGGCAGCTTGAGTCCTGGAGAGG - Intronic
1179572843 21:42288027-42288049 TGTCTGCTTTACCTCTTCAGAGG - Exonic
1179660084 21:42868703-42868725 TGTCCACTCCACCTCTGGAGGGG + Intronic
1180521951 22:16216970-16216992 TGTGAGCATAAGCTCTGGAGAGG + Intergenic
1180961706 22:19765311-19765333 TATCAGCTTGACCTCTCCAGCGG + Intronic
1181148509 22:20865942-20865964 TATCAGCTTGACCTCTGGTGGGG - Intronic
1181915287 22:26274909-26274931 TATTAGCTTGACCTCTGGAGAGG - Intronic
1181976057 22:26730791-26730813 TATCACGTTGACTTCTGGAGGGG - Intergenic
1183082393 22:35464851-35464873 TGGCAGCTTGCCCTCTTCAGGGG + Intergenic
1183596559 22:38816079-38816101 TATCAGTTTGACCTCTGGAGAGG + Intergenic
1185152050 22:49169417-49169439 TGGCAGCTGGCCCTCTGGTGTGG - Intergenic
950261958 3:11548930-11548952 TGCCAGATTGTCCTCTGCAGGGG + Intronic
950280280 3:11701343-11701365 TGTCTGCTTGGCTTCTGGAGAGG - Intronic
950826714 3:15830830-15830852 TATCAGCTTGACCTCTGGAGGGG + Intronic
953525758 3:43688935-43688957 TATCAGCTTGGCTTCTGGAAAGG + Intronic
955356409 3:58236579-58236601 TGGCCCCTTGACGTCTGGAGTGG + Intergenic
956700992 3:71958221-71958243 TGTCAACTTGAGATTTGGAGGGG + Intergenic
956775110 3:72558531-72558553 TGTCTGCTTGGCTTCTGGGGTGG - Intergenic
957237967 3:77619666-77619688 TGTCACCTCAGCCTCTGGAGGGG - Intronic
957702548 3:83735010-83735032 TATCAGCTTAACCTCTGGAGGGG - Intergenic
957996468 3:87696327-87696349 CCTCAGCTTGACCTTTGGTGTGG - Intergenic
958736015 3:98010455-98010477 TATCAGCTTGACCTCTGGAGGGG - Intronic
959635352 3:108561049-108561071 TGACAGCTTCACCTCTGGTTTGG + Intronic
960283429 3:115800706-115800728 TATCAGCCTGACCTCTGGGCAGG + Intergenic
961196215 3:125003639-125003661 TATCAGCTCAACCTCTAGAGGGG + Intronic
963334876 3:143963272-143963294 TATCACATTGACCTCTGGAGAGG + Intergenic
963849060 3:150190819-150190841 CATCTGCTTGGCCTCTGGAGAGG + Intergenic
964802988 3:160574602-160574624 TCTCAGCTGGATCTCTGAAGAGG + Intergenic
965106994 3:164369182-164369204 TGTCAGCTTGACTTTTGGAGGGG - Intergenic
965186215 3:165467804-165467826 TGACTGCTTGGCTTCTGGAGAGG + Intergenic
965296757 3:166956679-166956701 CATCAGTTTGACTTCTGGAGGGG - Intergenic
966612340 3:181880241-181880263 AGCCAGCCTGACCTCTGGTGAGG + Intergenic
966669932 3:182515528-182515550 TCTCAGCTTTACCACTAGAGAGG - Intergenic
967654758 3:192033625-192033647 TTTCAGCCTGACCCCTGAAGTGG + Intergenic
968950995 4:3691425-3691447 TGTCAGCATCACCCCAGGAGAGG + Intergenic
969061918 4:4442823-4442845 TGTCTGCTTTACCTATGGTGGGG - Intronic
969062075 4:4444360-4444382 CATCAGTTTGACCTCTGGAGGGG + Intronic
970384699 4:15544390-15544412 TATCAGCTTTTCCTCTGTAGGGG - Intronic
972037843 4:34549272-34549294 TATCAGTTTGATCTCTGGAGGGG + Intergenic
973665550 4:53155220-53155242 TTTCAGCTTGAGTTTTGGAGGGG - Intronic
976536046 4:86218711-86218733 TGTCATCTTGAATCCTGGAGAGG + Intronic
977780713 4:100977657-100977679 TGTCAGTTGGACCTGTAGAGAGG - Intergenic
979743952 4:124186223-124186245 TTTCAACTTGAGCTTTGGAGGGG - Intergenic
980425504 4:132622915-132622937 TATCAACTTGACCTCCGGAGGGG - Intergenic
980614737 4:135204587-135204609 TACCAATTTGACCTCTGGAGGGG + Intergenic
980725528 4:136755147-136755169 TATCACTTTGACCTTTGGAGGGG - Intergenic
980855844 4:138438719-138438741 TATCAGCTTGACCTCTGAGGGGG + Intergenic
982450339 4:155544874-155544896 TGTCCGCTGGACCTGTGAAGTGG - Intergenic
982465302 4:155723002-155723024 TGTTAGCCTAACCTCTGGGGAGG - Intronic
982926152 4:161339446-161339468 TTTCAGCATGAGATCTGGAGGGG - Intergenic
982986381 4:162212692-162212714 TATGAGCTTGACATTTGGAGAGG - Intergenic
986077769 5:4355935-4355957 TGTGAAAGTGACCTCTGGAGGGG + Intergenic
988065609 5:26226690-26226712 TTTCAGCTGGAGATCTGGAGAGG - Intergenic
988281250 5:29150106-29150128 TATCAGCCAGACATCTGGAGAGG + Intergenic
988682191 5:33494608-33494630 TGCCAGATTGTCCCCTGGAGAGG - Intergenic
991185718 5:63804314-63804336 TTTCAGCATGACTTTTGGAGGGG + Intergenic
991398034 5:66225050-66225072 TTTCAGCTTGAGATTTGGAGGGG + Intergenic
992180475 5:74192513-74192535 TGTCTGCTTTGCCTCTGCAGAGG - Intergenic
992598924 5:78376792-78376814 TGGCAGATTGATCTCTGGGGTGG + Intronic
993135020 5:83949937-83949959 GGTCAGCTTGACCACTGAAAAGG + Intronic
993761097 5:91798515-91798537 TGTCAGCTTCACCTATAGATAGG + Intergenic
994579304 5:101618218-101618240 TATCAGCTTGACCTCCAGAAAGG - Intergenic
995135192 5:108673025-108673047 TGTAAGTTTTACCTCTGCAGAGG + Intergenic
995245385 5:109929555-109929577 TGGCAGCTGGACAGCTGGAGAGG + Intergenic
995320153 5:110824860-110824882 TGTCAGCTGGACCTCAGCAGGGG + Intergenic
996096055 5:119400417-119400439 TTTCAGTTTGACTTCTGGAGGGG - Intergenic
997703530 5:135924804-135924826 TATCACCTTGACCTCAGGGGTGG + Intronic
998813363 5:145988242-145988264 TAGAAGCTTGACCTCTGGAGGGG - Intronic
1002431399 5:179206334-179206356 TGTCAGCTTGGCTCCTGGAGGGG + Intronic
1002573870 5:180160572-180160594 TGTCAGCTTTGCCTCTGGGAAGG + Intronic
1002899052 6:1395697-1395719 TGTCAGTTACACCACTGGAGGGG - Intergenic
1003823569 6:9927491-9927513 TGTCAGCATGACATCTAGTGTGG - Intronic
1004616715 6:17297399-17297421 TGACAGCTTGAGGTTTGGAGGGG + Intergenic
1007194511 6:40049078-40049100 GGTCAACAAGACCTCTGGAGAGG - Intergenic
1008091793 6:47301496-47301518 TGTCAGCATGAGATTTGGAGAGG - Intronic
1009604466 6:65849067-65849089 TTTCAGCATGATATCTGGAGGGG + Intergenic
1010003693 6:70973044-70973066 TATCAGCTTGAACTCTCAAGGGG - Intergenic
1011622560 6:89256654-89256676 TACCAGCTTAACCTCTGGAGGGG + Intergenic
1012691487 6:102318787-102318809 TATCAGTTTGACCTCTGTGGGGG + Intergenic
1014014959 6:116519319-116519341 CCTCAGCTTGACCTATGGGGGGG + Exonic
1017776621 6:157685917-157685939 GATCAGCTTGGTCTCTGGAGGGG + Intergenic
1019943638 7:4310172-4310194 TATCAGCTTGACCTCTGGATGGG - Intergenic
1019969443 7:4528331-4528353 GTTCAGTTTGACCTCTGGAGGGG + Intergenic
1020133899 7:5575182-5575204 TGTGAGCTTGGCGTCTGGGGAGG + Intergenic
1021584540 7:22193764-22193786 AGTCAGCTAGAACGCTGGAGAGG + Intronic
1021659826 7:22908855-22908877 TATCAGCTTGACCTCCAGAGGGG + Intergenic
1022533429 7:31081112-31081134 TGTCAGCTGGACCTTGGGAAAGG + Intronic
1022668459 7:32432530-32432552 GGTCAGCCTGTTCTCTGGAGGGG - Intergenic
1023734199 7:43220448-43220470 CATCAGCCTGATCTCTGGAGAGG - Intronic
1025298114 7:57792952-57792974 TGTCAGCTTGACCTTGGGAAGGG + Intergenic
1029198670 7:98824286-98824308 CATCAGCTTGACCTCCAGAGGGG + Intergenic
1029660340 7:101956286-101956308 TCTCAGCTTGGCATCCGGAGAGG - Intronic
1030484782 7:110151758-110151780 TGTCAGTTTGAGTCCTGGAGTGG + Intergenic
1031419936 7:121539459-121539481 TTTCAGCATGAGCTTTGGAGGGG - Intergenic
1031693958 7:124826096-124826118 TATCAGCTTGATCTCAAGAGGGG + Intronic
1033017035 7:137681862-137681884 TATCAGCTTGACCCCCAGAGGGG + Intronic
1035244401 7:157552840-157552862 GGCCAGCCTCACCTCTGGAGGGG + Intronic
1038180264 8:25220964-25220986 TGTTATCTGGACCTGTGGAGGGG + Intronic
1039316621 8:36380601-36380623 TGCCAGATTGCCCTCTGGAAAGG - Intergenic
1039811855 8:41056226-41056248 TGTGACCTTGACCTCTGGGCAGG - Intergenic
1040529860 8:48257810-48257832 TGTCAGCATGAGATTTGGAGGGG + Intergenic
1043710504 8:83411282-83411304 TATCAGTTTGACATCTGGAGAGG - Intergenic
1043799930 8:84595910-84595932 TCTCACCTTGCCCTCTGGAAGGG - Intronic
1047245293 8:123137683-123137705 TGTCAGTTTGACCTTTGGATGGG - Intronic
1047562461 8:126002715-126002737 TGTCAGTTTGACATCCGGAGGGG - Intergenic
1049665940 8:143842619-143842641 CATCAGCCTGACCTCTGCAGGGG + Intergenic
1052749463 9:32474582-32474604 TGTGAGATGGACCTGTGGAGAGG + Intronic
1053438626 9:38095236-38095258 TTTCAACATGAGCTCTGGAGGGG - Intergenic
1053701051 9:40690939-40690961 TGTGAGCATAAGCTCTGGAGAGG - Intergenic
1053795486 9:41723085-41723107 TCTCAGCTTGACCTTGGGAAGGG - Intergenic
1053798875 9:41750864-41750886 TGTCAGCTTGACCTTGGGAAGGG - Intergenic
1054146331 9:61564088-61564110 TGTCAGCTTGACCTTGGGAAGGG + Intergenic
1054149696 9:61591791-61591813 TGTCAGCTTGACCTTGGGAAGGG + Intergenic
1054183896 9:61935140-61935162 TCTCAGCTTGACCTTGGGAAGGG - Intergenic
1054187290 9:61962923-61962945 TGTCAGCTTGACCTTGGGAAGGG - Intergenic
1054312344 9:63490337-63490359 TGTGAGCATAAGCTCTGGAGAGG - Intergenic
1054411115 9:64814393-64814415 TGTGAGCATAAGCTCTGGAGAGG - Intergenic
1054466063 9:65495180-65495202 TGTCAGCTTGACCTTGGGAAGGG + Intergenic
1054469462 9:65522901-65522923 TGTCAGCTTGACCTTGGGAAGGG + Intergenic
1054651220 9:67625611-67625633 TGTCAGCTTGACCTTGGGAAAGG + Intergenic
1054654609 9:67653346-67653368 TCTCAGCTTGACCTTGGGAAGGG + Intergenic
1056223640 9:84473693-84473715 TATCAGCTTGACCTCTGGAGGGG + Intergenic
1056454695 9:86748555-86748577 TTTCAGCTTGAGTTTTGGAGGGG - Intergenic
1057197894 9:93125140-93125162 GGACAGCTTGACCGCTGGGGTGG - Intronic
1058575294 9:106394633-106394655 AGTCAGGTTGACATCTGGGGAGG + Intergenic
1059034495 9:110739466-110739488 TATTAGTTTGACCTTTGGAGGGG - Intronic
1059532048 9:115044121-115044143 TGGCAGCTTGTGCTATGGAGAGG + Intronic
1060017522 9:120099431-120099453 TGTCAGCTTGCCGTCTGGTCTGG - Intergenic
1061505392 9:131029037-131029059 AATCGGCTTCACCTCTGGAGGGG - Intronic
1185699789 X:2222314-2222336 GGCCAGCCTGACCTCTGGGGAGG - Intronic
1186093528 X:6075518-6075540 TGTCAGCTTGATACTTGGAGAGG - Intronic
1186179048 X:6954935-6954957 CATCAGCTTGACCTCCTGAGGGG - Intergenic
1186448365 X:9651698-9651720 TTTGTGCTTGAACTCTGGAGAGG - Intronic
1186847376 X:13544116-13544138 GGCCAGCTTGTTCTCTGGAGTGG + Intergenic
1186856135 X:13628035-13628057 TATCAACTTGACCACTAGAGAGG - Intronic
1187453882 X:19423831-19423853 TATCAGTTCGACCTCTAGAGAGG + Intronic
1187834805 X:23421153-23421175 TGTCTGCTTGACTTCTGGTGAGG - Intergenic
1188704910 X:33315382-33315404 TATCAGTTTGAACTCTGGAGAGG + Intronic
1189740537 X:44113259-44113281 TGTCAGCCTCACCTCTGGATTGG + Intergenic
1189775027 X:44462856-44462878 TGTGAGCTTGACCCCAGTAGAGG - Intergenic
1194668023 X:96697068-96697090 AGTCAGCTTGATCTTTGGGGTGG + Intronic
1194867025 X:99081875-99081897 TATCAGCTTGGCCTCTTTAGGGG + Intergenic
1195030474 X:100922808-100922830 TGTGAGCCTGATCTCTGCAGAGG - Exonic
1198270813 X:135054529-135054551 TGTCAGCTTGGATCCTGGAGTGG + Intergenic
1199505014 X:148551875-148551897 TATCAGTTTGACCTCTGGAGGGG + Intronic
1200357541 X:155567836-155567858 TGGCTGCCTGACCTCTGAAGTGG - Intronic
1201038638 Y:9807428-9807450 TGTCAGCCTGACCTAAGCAGAGG - Intergenic
1202232880 Y:22672863-22672885 TGTCACCTTCACGTCTGGATAGG + Intergenic
1202310276 Y:23523295-23523317 TGTCACCTTCACGTCTGGATAGG - Intergenic
1202560525 Y:26147298-26147320 TGTCACCTTCACGTCTGGATAGG + Intergenic