ID: 1169357372

View in Genome Browser
Species Human (GRCh38)
Location 20:4918914-4918936
Sequence GTGTGTGCACACATTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 353}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169357372 Original CRISPR GTGTGTGCACACATTGAGGA GGG (reversed) Intronic
900186456 1:1335436-1335458 GTGTGTGCACTCACCAAGGACGG + Exonic
900899166 1:5505141-5505163 GTGTGAGAACACAGTGAGAAGGG + Intergenic
902620231 1:17646551-17646573 GTGTGTGTGCACATGGAGGTAGG - Intronic
902752966 1:18530128-18530150 GTGAGAGCAGACAGTGAGGAGGG - Intergenic
904908665 1:33917436-33917458 GGATGTGCTCAAATTGAGGATGG - Intronic
905110759 1:35592802-35592824 GTGTGTCCTCACATTGTAGAAGG + Intronic
907155821 1:52332849-52332871 GTGTGTGTACAGAATGATGATGG + Exonic
909261482 1:73494870-73494892 GTGTGTGCATACATGTATGATGG + Intergenic
909546798 1:76857341-76857363 ATGACGGCACACATTGAGGAAGG - Intergenic
910880678 1:91919869-91919891 GTGTGAGCACACACTTATGAAGG + Intergenic
910984210 1:92989831-92989853 CTGTGTCCTCACATAGAGGAAGG + Intergenic
911304309 1:96214382-96214404 GCGTGTGCACACATTGGGGTGGG - Intergenic
911741428 1:101390160-101390182 ATGTTTGTACACATGGAGGAGGG + Intergenic
911746219 1:101444643-101444665 GTGTGAGCACACATTCCTGAAGG + Intergenic
913550275 1:119910626-119910648 GTGTGCCCACACTTTGTGGATGG + Intergenic
914077492 1:144369066-144369088 CTGTGTCCTCACATGGAGGAAGG + Intergenic
914101687 1:144597439-144597461 CTGTGTCCTCACATGGAGGAAGG - Intergenic
915079011 1:153338511-153338533 GTGTGTGCACTCAGTGCTGAGGG - Intronic
915832449 1:159143567-159143589 GTGTGTGTACACACTGAGCCTGG - Intronic
916400030 1:164437441-164437463 GTGCCTACACACATTGAGGGTGG - Intergenic
917051482 1:170929723-170929745 GTGTGTGGACTCATTTAGGTTGG - Intergenic
917240353 1:172941363-172941385 GGGTGAGCACATTTTGAGGAAGG + Intergenic
917981110 1:180269998-180270020 ATGTGTGTACACAGTGAGGGGGG - Intronic
918197530 1:182236136-182236158 CTGTGTGCACACATCAAGCAAGG + Intergenic
918819902 1:189239685-189239707 ATGTGTGTACAGATTGAGGTAGG + Intergenic
919584004 1:199413460-199413482 GTGCCTACACACACTGAGGAGGG - Intergenic
919794336 1:201312119-201312141 CTGCGTGCACACATGGAGGCAGG - Intronic
919806163 1:201382169-201382191 GTGTGTGCACACGGGGACGATGG + Intronic
920293445 1:204940499-204940521 GTGGGTGCACACATTGTGAATGG - Intronic
920724986 1:208426668-208426690 CTGTGTCCTCACATGGAGGAAGG + Intergenic
920898964 1:210087449-210087471 GAGTGTGTTCGCATTGAGGAAGG - Intronic
921821603 1:219623138-219623160 GTGTGTTCTCACATGGTGGAAGG - Intergenic
923385548 1:233462206-233462228 GTGCCTGCCCACATTGAGGGTGG + Intergenic
924463703 1:244282068-244282090 GTGTGTGCACACACAGAGTGAGG + Intergenic
1062771512 10:105006-105028 GGGTGTGCACACACTCAGGGCGG - Intergenic
1062886588 10:1021138-1021160 GTGTGTGCACATCTGCAGGAAGG - Intronic
1064934087 10:20660694-20660716 CTGTGTGCTCACATGGTGGAAGG - Intergenic
1066089354 10:32002654-32002676 CTGTCTGCACATATTGAAGAGGG + Intergenic
1067074203 10:43164432-43164454 GTGTGTGCACACATGCATGGGGG - Intronic
1067385697 10:45816276-45816298 TTGTGTCCTCACATTGTGGAAGG - Intronic
1067835296 10:49634571-49634593 GTGTGTGCACACAGAGAGAGTGG - Intronic
1068400648 10:56523350-56523372 TTGTTTGCACATATTGAAGAGGG + Intergenic
1069681867 10:70291308-70291330 TTGTGTGCACACACCAAGGAAGG - Intergenic
1071229509 10:83569041-83569063 GTACATGAACACATTGAGGAAGG + Intergenic
1071488907 10:86122830-86122852 GTGTGAGCACACATGAGGGAGGG + Intronic
1073431162 10:103488191-103488213 GTGTGTGCACCCCAGGAGGAGGG + Intergenic
1073611918 10:104952699-104952721 GTGTGTGCATGCATTTAGGCTGG - Intronic
1074134889 10:110617727-110617749 GTGTGAGCACACACTGAAGTGGG + Intergenic
1075179346 10:120196118-120196140 GTGTGTGCACAGGGTGATGATGG + Intergenic
1075335753 10:121607918-121607940 GTTTGTGTACACAGTGAGCACGG + Intergenic
1075405024 10:122189167-122189189 GTGTGTGCAGAGATTGGGGAGGG + Intronic
1075615096 10:123884996-123885018 GTGTGTGCAGACACTGTGCAGGG + Intronic
1076681418 10:132173486-132173508 GTGTGTGGACACCGTGAGGCTGG - Intronic
1077326316 11:1965548-1965570 GGTTGTGCACACACTGGGGAGGG + Intronic
1077888796 11:6404513-6404535 GTGTCTGCACACATTTGGCAGGG - Intronic
1079764126 11:24369415-24369437 GTGTTTACTCACATTGGGGAAGG - Intergenic
1083945371 11:65920084-65920106 GGGAGTTCACACACTGAGGAAGG + Intronic
1085126053 11:74003483-74003505 GCGTGTGGAGACAGTGAGGAAGG + Intronic
1085250880 11:75143021-75143043 GTGTGTGCACAGAATGTGGGGGG + Intronic
1085272403 11:75278125-75278147 GGGTGCCCACACCTTGAGGAGGG + Intronic
1085572699 11:77573068-77573090 GTGTCTGCAAACATTTAGAACGG - Intronic
1087534469 11:99425547-99425569 GAGTGTGCACACATTTGGGGTGG - Intronic
1088558962 11:111092905-111092927 GTGTGTGGACACACTAAGGAAGG + Intergenic
1088823944 11:113477993-113478015 CTGTGTTCACACATGGTGGAAGG + Intergenic
1089132769 11:116225195-116225217 GTGTGTGCCCACACAGGGGATGG - Intergenic
1089169021 11:116499749-116499771 GTGTGTGCGCACAGGGAGGGAGG - Intergenic
1089552182 11:119288454-119288476 GTCTGTGCAAACACTGAGGATGG - Intronic
1089731628 11:120522961-120522983 GTCTGTGCACACATTTTGTAAGG - Intronic
1090278793 11:125438680-125438702 GTGTGGGGACACATTTTGGAAGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1090788076 11:130068134-130068156 CTGTGTTCGCACATGGAGGAGGG + Intergenic
1091120194 11:133051038-133051060 GTATGTACACACATGGAGGAGGG - Intronic
1202809297 11_KI270721v1_random:20727-20749 GGTTGTGCACACACTGGGGAGGG + Intergenic
1091451155 12:572583-572605 GTGTGTGCACACAGTGTGACAGG - Intronic
1091667514 12:2430093-2430115 GTGTGTCCTCACATGGTGGAAGG + Intronic
1091958260 12:4667108-4667130 CTGTGTGCTCACATGGTGGAAGG + Intronic
1093269458 12:17041495-17041517 GTGCTTGCACGCATGGAGGAAGG - Intergenic
1094667286 12:32533309-32533331 GTGTCTGGACACAAAGAGGAGGG + Intronic
1095106936 12:38245257-38245279 GTGCCTGCCTACATTGAGGAAGG + Intergenic
1096038179 12:48491283-48491305 CTGTGTCCTCACATGGAGGAAGG + Intronic
1097548592 12:61037279-61037301 GTGTGTGCACACCATGAGTTGGG + Intergenic
1097903016 12:64891902-64891924 GTAGGGGCTCACATTGAGGAGGG + Intergenic
1098111150 12:67123169-67123191 GTGTGTCCTCACATGGTGGAAGG + Intergenic
1098302945 12:69072619-69072641 GTCTGTGGATACATTGATGATGG - Intergenic
1099221310 12:79918339-79918361 TGTTGTGCACACATGGAGGAGGG - Intronic
1100070392 12:90709270-90709292 GTGTCTGCTCACATGGAGGGCGG + Intergenic
1101860917 12:108481774-108481796 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1101960842 12:109248683-109248705 GTGCGCACCCACATTGAGGATGG + Intronic
1102688645 12:114743457-114743479 ATGTGTGCACACACTCATGAAGG + Intergenic
1102708505 12:114904336-114904358 GTGTGTGCACACTGTGTGGGGGG + Intergenic
1103071323 12:117945022-117945044 AAGTGTGTACACATTTAGGATGG - Intronic
1103131946 12:118476966-118476988 ATGTGTGCACACATAGAAAAGGG - Intergenic
1103228148 12:119305532-119305554 GTGCCTGCCCACACTGAGGATGG - Intergenic
1104272126 12:127292130-127292152 ATGCCTGCACACATTGATGAGGG - Intergenic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1104955283 12:132461896-132461918 TTGTGTGCTCGCATGGAGGATGG - Intergenic
1105561454 13:21496296-21496318 CTGTGTGCACACAGAGAGAAAGG - Intronic
1106029862 13:25990384-25990406 GTGGGTGCAGACAGTGATGAGGG + Intronic
1106530947 13:30590789-30590811 GTGTGTCCTCACATGGTGGAAGG - Intronic
1107458025 13:40573034-40573056 TAGTGTGGGCACATTGAGGAGGG - Intronic
1107530876 13:41281125-41281147 GTGTGAGCACACACTCAGGAAGG + Intergenic
1107634102 13:42374598-42374620 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1107752248 13:43580685-43580707 TTGCGTGCAAACAGTGAGGAAGG - Intronic
1107872292 13:44758670-44758692 GTGTGTGCACACAAAGGAGAGGG + Intergenic
1108966597 13:56313483-56313505 GAGTGAACACAAATTGAGGATGG + Intergenic
1109233523 13:59787908-59787930 CTGTGTCCTCACATTGTGGAAGG - Intronic
1110522562 13:76498102-76498124 ATGTGTGCAGAAATAGAGGAAGG + Intergenic
1111324860 13:86681291-86681313 GTGTGTGCATAAATTGATCATGG - Intergenic
1111428654 13:88123737-88123759 GTGTGAGGACACAGTGAGAAGGG + Intergenic
1112143209 13:96669488-96669510 ATCTGAGCTCACATTGAGGAAGG + Intronic
1113271196 13:108676625-108676647 GTGTGGGCACACACAGAGGGAGG + Intronic
1113501539 13:110779355-110779377 CTGTGTGCTCACATGGTGGAAGG + Intergenic
1113797119 13:113065052-113065074 GTGTGCGCACACAGAGAAGAAGG + Exonic
1117670500 14:58101080-58101102 GTGTCTGCACACATTCTGTAGGG + Intronic
1118148056 14:63162104-63162126 CTGTGTCCTCACATTGGGGAAGG - Intergenic
1118386714 14:65261785-65261807 CTGTGTCCTCACATTGTGGAAGG + Intergenic
1118669205 14:68103635-68103657 GTGTTAGTACAAATTGAGGAAGG + Intronic
1118907446 14:70032968-70032990 GTGTGTGCACACAGGGAAAAAGG - Intergenic
1119502276 14:75140033-75140055 CTGTGTTCTCACATGGAGGAAGG - Intronic
1119853545 14:77883004-77883026 GTGTGTGCACACATGTGCGAAGG - Intronic
1120096451 14:80394298-80394320 GTGTTTGGATACATTTAGGAGGG - Intergenic
1120312128 14:82842444-82842466 TTGTGTGCATATCTTGAGGAAGG + Intergenic
1120313457 14:82861033-82861055 GTGTGTGCAACCCTTGAGGCAGG + Intergenic
1120929745 14:89836504-89836526 GTGTGTCCACACAGTGTGTAAGG + Intronic
1121663920 14:95657649-95657671 GTGCCCGCCCACATTGAGGAGGG - Intergenic
1122146835 14:99695473-99695495 AGGTGTGTACACATTTAGGATGG + Intronic
1122810674 14:104286267-104286289 CTGTGTCCTCACATGGAGGACGG + Intergenic
1124572585 15:30878666-30878688 CTGTGTCCACACATGGTGGAAGG - Intergenic
1125002860 15:34789441-34789463 GTGTGTGAACTCCTCGAGGATGG + Exonic
1126624892 15:50677187-50677209 GTGTCTTCACACAGTGAAGAGGG + Intronic
1127743327 15:61936908-61936930 GTGTGTGCACACAGTAAACAAGG - Intronic
1128153318 15:65377005-65377027 GCGTGTGCACACTTCGGGGAAGG + Intronic
1128643129 15:69354794-69354816 GTGTCTGCCCACACTGAGGGTGG - Intronic
1128720423 15:69943657-69943679 GTGTGTGGGCTCCTTGAGGAAGG - Intergenic
1129063570 15:72881287-72881309 GTGTGGGCCCACATTGAGTGAGG + Intergenic
1129077359 15:73008377-73008399 GTGCCTGCCCACATTGAGGGTGG + Intergenic
1129977742 15:79836619-79836641 GCGTGCGCGCACATGGAGGAGGG + Intronic
1130557683 15:84934294-84934316 GTGTGTGTACATGTTGAGGAGGG + Intronic
1132025257 15:98399648-98399670 CTGTGTGCTCACATGGAGGAAGG - Intergenic
1135290947 16:21237559-21237581 CTGTGTCCTCACATGGAGGAAGG + Intronic
1135324627 16:21518625-21518647 GTGTGTGTACACATTCAAGGTGG - Intergenic
1135698784 16:24613274-24613296 GTGTGTGAAGGCCTTGAGGAGGG + Intergenic
1136392204 16:29972866-29972888 ATGTGTGCAGAAATTGAGGAAGG - Intronic
1137390921 16:48081000-48081022 ATGTGTCCTCACATGGAGGAAGG + Intergenic
1137502200 16:49020039-49020061 GTGTGTGCACACGTGGAAGGCGG - Intergenic
1140217375 16:73019439-73019461 GTGTGTTCACACTTGGTGGAAGG - Intronic
1142036838 16:87867671-87867693 GTGTGTGTACACATTCAAGGTGG - Intronic
1143866854 17:9929890-9929912 CTGTGAGGACACTTTGAGGAAGG - Intronic
1144111545 17:12039745-12039767 GTATGTGCACACATTGTGTTTGG + Intronic
1144704765 17:17361127-17361149 GTGTGTGAAAATATTGAGGGAGG - Intergenic
1144711773 17:17406000-17406022 GTGTGTCCACACATACAGGTGGG + Intergenic
1144825636 17:18104202-18104224 GTGTGTGCGCACCAGGAGGATGG - Intronic
1145759428 17:27417805-27417827 GTGTGTGCACACATGTATGTAGG - Intergenic
1146632391 17:34480166-34480188 GTTTTTGCATACATTCAGGAGGG + Intergenic
1147876391 17:43623957-43623979 GTATGTCCAAACATTTAGGAGGG - Intergenic
1150728969 17:67675280-67675302 GTGTGTGTACACCATGGGGAAGG + Intronic
1150841102 17:68606395-68606417 GTGTGTTCATACATGGAGGTGGG + Intergenic
1151345976 17:73501418-73501440 CAGTGTCCACACCTTGAGGAGGG + Intronic
1151563326 17:74882699-74882721 GGCTGTGCACACCTAGAGGAGGG + Exonic
1152103481 17:78316009-78316031 GTGGGTGCACAGATCGAGGCTGG - Intergenic
1152346377 17:79754855-79754877 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1152470040 17:80486027-80486049 GTGTGTGCTCACTGTGAGCAGGG - Intergenic
1153431977 18:5027829-5027851 GTGTGTTCTCACATGGTGGAGGG - Intergenic
1153690700 18:7590399-7590421 GAGTGTGCACACCTGGAGGGTGG + Intronic
1153981107 18:10311404-10311426 GTTTGTGCACATGTAGAGGATGG - Intergenic
1155623260 18:27805950-27805972 GTGTGTAGAAAAATTGAGGATGG - Intergenic
1156534277 18:37847769-37847791 GTGTGTGCACGCATGCAGGCAGG - Intergenic
1156940422 18:42760300-42760322 GTGTGTCCAGCCATTGAGGCAGG - Intronic
1157513184 18:48293257-48293279 TTGTGTGCATGCAGTGAGGAAGG - Intronic
1157818871 18:50750948-50750970 GTGTGTCCTCACATGGTGGAAGG - Intergenic
1159160903 18:64642577-64642599 ATCTGTTCACACAGTGAGGAGGG + Intergenic
1163833454 19:19558995-19559017 GTGTGTGGACACCTCGAGGTAGG + Intergenic
1164979601 19:32603900-32603922 CTGTGTTCACACTGTGAGGATGG + Intronic
1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG + Exonic
1166869874 19:45864574-45864596 GTGTGGGCTCACATGGAGCAGGG + Intronic
1167906001 19:52661340-52661362 GTGTGTGGACATTTTCAGGAGGG - Intronic
1168469590 19:56629548-56629570 CTGTGCCCACACATGGAGGAAGG - Intergenic
925138390 2:1534917-1534939 GAGACTGCACACATTGGGGAGGG - Intronic
926324741 2:11774742-11774764 GTGTGTGCTGACATGGAGGTTGG + Intronic
926762516 2:16291542-16291564 ATAGGTGCACACATTGTGGAGGG - Intergenic
927050513 2:19323638-19323660 CTGTGTCCTCACATTGTGGAAGG + Intergenic
927467438 2:23347950-23347972 CTGAGAGCACACAGTGAGGAAGG + Intergenic
928824658 2:35405527-35405549 CTGTGTGCAAGCACTGAGGAAGG - Intergenic
930316928 2:49808642-49808664 GGGTGTGCAGACTTTGAAGAGGG - Intergenic
930603484 2:53468800-53468822 CTGTGTGCACACACCAAGGAAGG - Intergenic
931763761 2:65436929-65436951 GTGTGTGCGCGCGTTGGGGAGGG + Intergenic
931976801 2:67652266-67652288 ATGTGTGCACTCATTTAGGTTGG - Intergenic
931998238 2:67859459-67859481 GTGTGTGTGCACATGGAGGGTGG - Intergenic
934662030 2:96148095-96148117 GGGTGAGGACACAATGAGGAGGG + Intergenic
935180621 2:100687371-100687393 CTGTGTCCTCACATGGAGGAAGG - Intergenic
935271756 2:101440853-101440875 CAGTGTGCATACATTTAGGATGG + Intronic
935467841 2:103420475-103420497 GTGTGTATACATATTGAAGAGGG + Intergenic
935809654 2:106785194-106785216 CTGTGTCCTCACATTGTGGAAGG + Intergenic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
940008358 2:149030397-149030419 CTGTGTCCACACATGGTGGAAGG + Intergenic
940063556 2:149599934-149599956 GTATCTGCCCACATTGAGGGTGG + Intergenic
942215509 2:173715485-173715507 GTACATGCACACAGTGAGGATGG - Intergenic
942987443 2:182160369-182160391 GTGCCTGCCCACATTGAGGGTGG - Intronic
944284013 2:197927378-197927400 GAGGGTGAATACATTGAGGAGGG - Intronic
944357134 2:198804069-198804091 GTGTGTGCACAGAATGAGCCCGG - Intergenic
948116521 2:235497527-235497549 GTGTATGCACATACAGAGGAAGG - Intronic
948572916 2:238928540-238928562 GTGTGTGCAGAATTTCAGGAGGG + Intergenic
948857802 2:240738325-240738347 GTGGGTGCACCCTTTGAGGCAGG - Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1168895898 20:1323257-1323279 GTGTGTGTACACAGTGGGGAAGG - Intronic
1169357372 20:4918914-4918936 GTGTGTGCACACATTGAGGAGGG - Intronic
1169877159 20:10310732-10310754 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1171395361 20:24829521-24829543 GGGTCTGCACACATTGAACATGG + Intergenic
1172105602 20:32515520-32515542 GTGGGTGCACACTGAGAGGATGG + Intronic
1173049215 20:39542915-39542937 GTGTGAGCAGAAATTGTGGAAGG - Intergenic
1174358697 20:50014985-50015007 GTGTGAGCACACATGCAGCAGGG + Intergenic
1174650420 20:52120107-52120129 CTGTGTCCACACATGGTGGAAGG - Intronic
1175335336 20:58192500-58192522 GTGTGAGCACTCAGTGAAGATGG + Intergenic
1175407375 20:58743968-58743990 GTGGGTGGATACATGGAGGAGGG + Intergenic
1175720248 20:61281368-61281390 GTGTCTCCACACATGGGGGAAGG - Intronic
1175744080 20:61441656-61441678 ATGTGTGCTCACATGGAAGACGG - Intronic
1175910591 20:62403542-62403564 GTCTGTCCACACCTTGAGGTTGG + Intronic
1178631490 21:34265098-34265120 TTGTGTCCTCACATGGAGGAAGG - Intergenic
1179527520 21:41992317-41992339 GTGTGTCCACACTTTGAAGTTGG + Exonic
1180060110 21:45380659-45380681 GTGTGTGCACAGATGGATGCTGG - Intergenic
1180060130 21:45380793-45380815 GTGTGTGCACAGATGGATGCTGG - Intergenic
1181048958 22:20229765-20229787 GTGTGTGTCCACATGGGGGAAGG - Intergenic
1181385067 22:22538713-22538735 GTGTGGGGACACCATGAGGAAGG - Intergenic
1184269952 22:43374378-43374400 GTGCCTGCCCACATTGGGGAGGG + Intergenic
1184677222 22:46050316-46050338 GTGTGTGAACACATCGATGAGGG + Exonic
949091589 3:35477-35499 GTGCGTGCGTACATTGAGGTGGG + Intergenic
949806032 3:7956823-7956845 CTGTGTCCTCACATAGAGGATGG + Intergenic
950251445 3:11468932-11468954 GTGTGTGGGCAGATTGAGGATGG + Intronic
951337060 3:21436161-21436183 GTGTGTGTACACACAGATGAGGG + Intronic
951702662 3:25511791-25511813 CTCTGTGCACAACTTGAGGATGG + Intronic
954169418 3:48788701-48788723 GTGTGTTCTCACATGGTGGAAGG - Intronic
954483811 3:50827398-50827420 GTGTGTCCTCACATAGAGGAAGG + Intronic
955663262 3:61323985-61324007 GTGTGTGCGCGCGTTGGGGAGGG + Intergenic
955912360 3:63870381-63870403 GTGTGTGCACATGTTGGGGGTGG - Intronic
957903282 3:86525391-86525413 GGGAGTGCACACATTGCAGAAGG + Intergenic
959389790 3:105759611-105759633 GGGTGTGCACACACTCAGGGTGG - Intronic
960004306 3:112766438-112766460 GTGTGTCCTCACATGGAGGAAGG - Intronic
960218765 3:115077402-115077424 CTGTGCCCACACATTGTGGAAGG - Intronic
961002567 3:123383910-123383932 GTGTGTGCATGCCTTGAGGAAGG - Intronic
961631972 3:128307720-128307742 GCCTGTGCACACATTGGGCAGGG + Intronic
962966543 3:140359453-140359475 ATGTGTACACACATTAAGAAAGG + Intronic
963202602 3:142600209-142600231 TTGAGTGTACACAGTGAGGAGGG + Intronic
963479970 3:145860065-145860087 GTGTGTGTACACATGTGGGATGG + Intergenic
964736243 3:159921604-159921626 CTGTGTCCACACATGGTGGAGGG + Intergenic
964832748 3:160903714-160903736 GTGTGTGCACACATGGAGGTGGG + Intronic
966702959 3:182876664-182876686 CTGTGTCCACACATGGTGGAAGG + Intronic
969035840 4:4252920-4252942 GTTGGTGCAAACATTGAAGATGG - Intergenic
969453975 4:7290658-7290680 ATGTGTGCATACATGGATGAGGG - Intronic
970550673 4:17177960-17177982 CTGTGTCCTCACATGGAGGAAGG + Intergenic
971349697 4:25844897-25844919 GTGTGTGCACATAGTGGGGAGGG - Intronic
971456590 4:26850938-26850960 GTGCCTGCTCACATTGAGGGTGG - Intergenic
971657975 4:29374238-29374260 GTGTGTGCACACAGACAGGAGGG + Intergenic
974610598 4:64210401-64210423 CTGTGTGCTCACATGGTGGAAGG - Intergenic
974832427 4:67206099-67206121 GTGTGTGCACACAACCAGCATGG + Intergenic
974975770 4:68889095-68889117 GTGCCTGCCCACATTGAGGGTGG + Intergenic
976966058 4:91042531-91042553 GTCTGTGCATACATTAATGAAGG + Intronic
976989243 4:91344197-91344219 ATGTGTTCTCACATGGAGGAAGG - Intronic
977247502 4:94650324-94650346 GTATTTGCCAACATTGAGGAAGG - Intronic
977650944 4:99468899-99468921 GATTGTGGATACATTGAGGAAGG + Intergenic
977952597 4:102990770-102990792 GTGCATGGACACATTGAGGAAGG + Intronic
978488081 4:109278945-109278967 CTGTGTTCACACATGGTGGAAGG + Intronic
978622037 4:110642072-110642094 GTGTGTGCACACAGTGGAGAGGG - Intronic
980614588 4:135202332-135202354 CTGTGTCCTCACATGGAGGAAGG - Intergenic
983465622 4:168084910-168084932 GTGTGTCCTCACATGGTGGAAGG + Intergenic
985377931 4:189361908-189361930 GTGTGTGCGCGCATGTAGGAAGG - Intergenic
985748241 5:1659903-1659925 GTGTGAGGACACACGGAGGAGGG - Intergenic
985762187 5:1755006-1755028 GTGTGAGGACACAGGGAGGAGGG + Intergenic
986201888 5:5586652-5586674 GTGTGTCCTCACATGGAGGAAGG + Intergenic
986312239 5:6560131-6560153 GTGTGTGCACACAGTCATTAGGG - Intergenic
986722262 5:10567765-10567787 GTGTGTGCAAAGACTGAGGTGGG + Intronic
986878182 5:12136575-12136597 GTGTGTGCAGAAATTGTGAATGG - Intergenic
987070221 5:14329434-14329456 ATGTGTCCTCACATGGAGGAAGG - Intronic
988563261 5:32299780-32299802 GTGTGTGCACACATGTGTGATGG - Intronic
989613276 5:43315332-43315354 GTGAGTGCACACTTGGACGAGGG + Intergenic
989734761 5:44690501-44690523 CTGTGTCCTCACATGGAGGAAGG + Intergenic
989824786 5:45839828-45839850 ATGTCTGCTCACATTGATGAGGG + Intergenic
990282915 5:54270892-54270914 GTGCCTGCCCACATTGAGGGTGG - Intronic
991042573 5:62191213-62191235 GTGTCTGCCCACACTGAGGATGG - Intergenic
992707082 5:79407008-79407030 GTGTGTGCACACCTCAAAGAAGG - Intronic
992845108 5:80738914-80738936 GTGTGTCTTCACATGGAGGAGGG - Intronic
993699094 5:91097231-91097253 GTGTGTCCTCACATGGTGGAAGG + Intronic
993860626 5:93132474-93132496 TTGTGTTCCCACATTGAGCAAGG - Intergenic
994491663 5:100453793-100453815 GTGTGTGCATACATGCAGCAGGG - Intergenic
996908594 5:128631186-128631208 GTGTCCACACACATTGAGGTTGG + Intronic
996976500 5:129440693-129440715 GTGCCTGCCCACATTGAGGGCGG + Intergenic
997352118 5:133238635-133238657 GAGTGTGCACACATGGGGGAGGG + Intronic
997755196 5:136389613-136389635 CTGTGTGCTCACATTTAGAATGG - Intronic
997849258 5:137316160-137316182 CTGTGTGCTCACATGGTGGAAGG + Intronic
997991137 5:138545148-138545170 CTGTGTCCACACTTTGAAGATGG + Intergenic
1000078668 5:157822021-157822043 ATGTGTGCAAAACTTGAGGATGG - Intronic
1000284083 5:159811528-159811550 CTGTGTGCTCACATGGTGGAAGG - Intergenic
1000951248 5:167485930-167485952 GTGTGTGTGCACATAGATGAAGG - Intronic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002999851 6:2320602-2320624 GTGTGAGCACACAGTCATGAAGG + Intergenic
1004295222 6:14403981-14404003 GAGTGAGCACAGAATGAGGAAGG - Intergenic
1004522676 6:16377090-16377112 GTGTGTCCTCACATGGTGGAAGG - Intronic
1004856368 6:19755062-19755084 GTGTGTGCAATCAAGGAGGATGG - Intergenic
1006915104 6:37588755-37588777 GTCTGTGCACGCCTTGAGGCTGG - Intergenic
1007028970 6:38609512-38609534 GTGTATGTACACATAGAAGAAGG - Intronic
1008688139 6:53946379-53946401 GTGAGTGCCCACATGGAGGCAGG + Intronic
1009516482 6:64625494-64625516 CTGTGTCCTCACATTGTGGAAGG + Intronic
1009815362 6:68726335-68726357 CTGTGTGCACATCTTGAGAAAGG - Intronic
1011860917 6:91754923-91754945 GTGTCTGCACACATTGTGTGTGG - Intergenic
1012276849 6:97284468-97284490 GTGTGTGCAGAGAGAGAGGAGGG - Intergenic
1012728769 6:102852404-102852426 GTGTGTGTACAAATGGAGTAAGG - Intergenic
1017559223 6:155608751-155608773 GTGTGTGCACACATGCACGTAGG - Intergenic
1017744582 6:157435330-157435352 GTGCTTGCACACATGGAGGGAGG + Intronic
1018269855 6:162065443-162065465 GTGCCTACCCACATTGAGGATGG + Intronic
1018315135 6:162549153-162549175 GGGTGTCCTCACACTGAGGAAGG - Intronic
1018518354 6:164613962-164613984 GTGTTTGCACACTATCAGGAAGG - Intergenic
1018663075 6:166106185-166106207 TTCTGTGCACACACAGAGGAGGG + Intergenic
1019993171 7:4706568-4706590 GATTCTGCCCACATTGAGGAAGG - Intronic
1021062465 7:16130939-16130961 GTGTGTCCTCACATGGTGGAAGG - Intronic
1021660308 7:22913400-22913422 GGGTGTGCACACAGTGAAGTCGG - Intergenic
1022407195 7:30101482-30101504 CTGTGTCCTCACATGGAGGAAGG + Intronic
1022557800 7:31317195-31317217 GTGTGTGCACAGATTTAGGGTGG - Intergenic
1023020312 7:36006273-36006295 GTGTGTGCACCCAGTGATGAAGG - Intergenic
1023062466 7:36341762-36341784 GTGTGTCCTCACATGGTGGAAGG - Intronic
1023407208 7:39847378-39847400 GTGTGTGCACACATTACTGTAGG - Intergenic
1023557626 7:41439545-41439567 TTGTGTGCAGACATTCTGGAGGG - Intergenic
1023662226 7:42481536-42481558 GTGTGTGCACAGCAGGAGGAGGG + Intergenic
1024784457 7:52891177-52891199 GTGTGGTCATACACTGAGGAAGG + Intergenic
1026519198 7:71101869-71101891 GTGTGGGCACACACTGAGCCAGG - Intergenic
1027965156 7:84994752-84994774 GTGTGTCCTCACATAGTGGAAGG - Intergenic
1028231291 7:88309308-88309330 GGGTGTGCACCCATGGAAGAAGG + Intergenic
1028766770 7:94568802-94568824 CTGTGTCCACACATGGTGGAAGG - Intergenic
1028772854 7:94646995-94647017 GTGTGTACACACATAGAATATGG - Intronic
1028906519 7:96160560-96160582 CTGTGTCCTCACATGGAGGAAGG + Intronic
1029331971 7:99865076-99865098 GTCTGTACACACTTAGAGGATGG - Intronic
1032534141 7:132646556-132646578 CTGTGAGGACACAGTGAGGATGG + Intronic
1032591372 7:133194819-133194841 TGGTGCACACACATTGAGGATGG - Intergenic
1032845259 7:135746728-135746750 GTTTGTGCACACAATGAAAAGGG + Intronic
1033041083 7:137918817-137918839 GAATGTGCACACTTTGAGAATGG - Intronic
1035628544 8:1091530-1091552 GTGTGTGCACACACATAGGTGGG - Intergenic
1038326157 8:26574294-26574316 GTGCGTGCACCCATTGAGCATGG + Intronic
1038746782 8:30261742-30261764 GCGTCTGCCCACATTGAGGGTGG - Intergenic
1038865995 8:31439501-31439523 GTGTGAGCACACACTCATGAAGG - Intergenic
1039214604 8:35256078-35256100 GTGTGTATACACATAGGGGAAGG - Intronic
1039546348 8:38413862-38413884 GTGCGTGCACGCAGTGGGGACGG + Intronic
1040665061 8:49621727-49621749 GTGAGTGCACACCTGGAGAAGGG - Intergenic
1040889736 8:52304819-52304841 CTGTGTTCTCACATGGAGGAAGG + Intronic
1041174760 8:55183918-55183940 AGGTGTGTACACATTGAGGATGG + Intronic
1042164543 8:65933098-65933120 GTGTGTGCATGCATGGGGGAGGG + Intergenic
1043001795 8:74768657-74768679 GTGTCTACCCACATTGAGGGTGG + Intronic
1043264485 8:78246671-78246693 GTGTGTGCACACCTTGATACAGG + Intergenic
1043585207 8:81760680-81760702 TTGTGTCCTCACATGGAGGAAGG - Intergenic
1043882933 8:85565367-85565389 GTATGTCCTCACATTGATGATGG + Intergenic
1043982668 8:86659161-86659183 GCAGGTGCACACATTGAGGGAGG - Intronic
1044082068 8:87897469-87897491 GTGTCCACCCACATTGAGGATGG - Intergenic
1045342919 8:101270373-101270395 GTGCCTGCCCACATTGATGAGGG - Intergenic
1046190916 8:110792923-110792945 ATGTGAGCACACATTCATGAAGG - Intergenic
1046358204 8:113115943-113115965 CTGTGTCCTCACATAGAGGAAGG - Intronic
1047168240 8:122464317-122464339 GTGCGTGCACACACAGAGGAGGG - Intergenic
1047309048 8:123676879-123676901 GTGTGTGCATGCATGCAGGAAGG + Intergenic
1047539347 8:125749347-125749369 GTCTGTGCACACAGTAAGCATGG + Intergenic
1049113254 8:140663228-140663250 GTGTGTACACACATAGACAATGG + Intronic
1049364217 8:142228927-142228949 ATGTGTGAACAGATTGTGGATGG + Intronic
1050947888 9:11549530-11549552 GAGTGTGCACACATTCATGGTGG + Intergenic
1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG + Intergenic
1054342601 9:63880017-63880039 TTGTGTCCTCACATTGTGGAAGG + Intergenic
1060431677 9:123556197-123556219 ATGTGAGCACACAGTGACGATGG + Intronic
1060481933 9:124021550-124021572 GAGTGTGGAGACAATGAGGATGG - Intronic
1061090638 9:128424126-128424148 GTGTCTGCAAACTTTGAGGAGGG - Exonic
1061272709 9:129552564-129552586 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1062590252 9:137271357-137271379 GTGTGCGGACAGGTTGAGGATGG - Intronic
1062619642 9:137414319-137414341 GTCTGTGCACACAGTGGGGCAGG - Intronic
1185938513 X:4286008-4286030 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1186057090 X:5661289-5661311 CTGTGTCCACACATAGTGGAAGG - Intergenic
1186576240 X:10768974-10768996 GGGTGTGCACACATGTAGGAGGG + Intronic
1187446168 X:19363259-19363281 GTGTGTCCTCACATGGTGGAAGG - Intronic
1187533569 X:20117379-20117401 CTGTGTTCACACATTGAGTGAGG - Intergenic
1188808978 X:34628970-34628992 ATTTGTGCACACACTTAGGATGG - Exonic
1189373978 X:40451999-40452021 GTGGGTTCACACACTTAGGATGG + Intergenic
1191943189 X:66501762-66501784 GTGTGAGCACACACTAATGAAGG - Intergenic
1192543476 X:71994322-71994344 GTGTGTGTAAAAGTTGAGGAAGG + Intergenic
1192798634 X:74445196-74445218 ATGTGTGCATGCATTGAGGTGGG + Intronic
1193651411 X:84138835-84138857 GTGTGTGTACATTCTGAGGAAGG + Intronic
1194840773 X:98738562-98738584 GTGTGTGCATATTTTGGGGAGGG - Intergenic
1195559730 X:106269756-106269778 GTGTGTGCTCACATTCAACATGG + Intergenic
1195562231 X:106296583-106296605 GTGTGTGCTCACATTCAACATGG - Intergenic
1197656745 X:129125024-129125046 GGGAGTGGACACATTCAGGAGGG - Intergenic
1198183194 X:134230027-134230049 GTGTATGCACAAATTAAGGAGGG - Intergenic
1198747094 X:139901853-139901875 GTGTGAGCACACACTCATGAAGG - Intronic
1198753108 X:139954948-139954970 CTGTGTCCTCACATTGCGGAAGG + Intergenic
1198962497 X:142197018-142197040 GTGCGTGCACACATGGGGCAGGG - Intergenic
1200047270 X:153409624-153409646 GTGTGTGGACACATTGGTGGTGG - Intergenic
1200089419 X:153627331-153627353 GTGTGTGGACACATTGGTGGTGG + Intergenic