ID: 1169361272

View in Genome Browser
Species Human (GRCh38)
Location 20:4951317-4951339
Sequence GCTTACTTCTGAGTTAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169361272_1169361277 15 Left 1169361272 20:4951317-4951339 CCAGCACTAACTCAGAAGTAAGC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1169361277 20:4951355-4951377 ACAAAAGACTGAAACGGAGGTGG 0: 1
1: 0
2: 0
3: 15
4: 212
1169361272_1169361276 12 Left 1169361272 20:4951317-4951339 CCAGCACTAACTCAGAAGTAAGC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1169361276 20:4951352-4951374 ATCACAAAAGACTGAAACGGAGG 0: 1
1: 0
2: 1
3: 16
4: 218
1169361272_1169361278 16 Left 1169361272 20:4951317-4951339 CCAGCACTAACTCAGAAGTAAGC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1169361278 20:4951356-4951378 CAAAAGACTGAAACGGAGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 154
1169361272_1169361275 9 Left 1169361272 20:4951317-4951339 CCAGCACTAACTCAGAAGTAAGC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1169361275 20:4951349-4951371 GGCATCACAAAAGACTGAAACGG 0: 1
1: 0
2: 2
3: 27
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169361272 Original CRISPR GCTTACTTCTGAGTTAGTGC TGG (reversed) Intronic
901165678 1:7220086-7220108 GCTGACATCTGAGTTAGCTCAGG - Intronic
904282126 1:29427890-29427912 GCTTACACTTTAGTTAGTGCAGG - Intergenic
904331517 1:29760942-29760964 CCTGACTTCTGAGTAAGTGGAGG + Intergenic
904519539 1:31084027-31084049 GCTTACTTAGGAGGTGGTGCTGG + Intergenic
904886560 1:33742841-33742863 GCTGACCTCTGAGTTCGTGCCGG - Intronic
904948670 1:34218165-34218187 GCTTATTTCTGAGTCAGGGATGG + Intronic
917100894 1:171443968-171443990 GCTTGGTTCTGAGATAGTGAAGG + Intergenic
917511547 1:175673226-175673248 GCTTCCTCCTGGGTCAGTGCAGG - Intronic
917684001 1:177397297-177397319 CCCTTCTTCCGAGTTAGTGCTGG - Intergenic
917690978 1:177468786-177468808 GCTAACTTCTTAGATTGTGCAGG + Intergenic
920081284 1:203374667-203374689 GCATACTTCGGAGATATTGCAGG + Intergenic
921897820 1:220419394-220419416 GCGTACTTCAGAGATATTGCAGG - Intergenic
921909427 1:220530055-220530077 GCTCACTTCTGAGTTGTTGGAGG + Intronic
923285694 1:232492849-232492871 GTGGACTTCTGAGTTAATGCTGG + Intronic
924869097 1:248021133-248021155 GATTACATCTGAGTTTGTGTTGG + Intronic
1064620847 10:17215632-17215654 GCTGGCTTCTGGGGTAGTGCAGG - Intergenic
1065740925 10:28796574-28796596 GCTCACTTTTGTATTAGTGCAGG - Intergenic
1066496786 10:35949930-35949952 TTTTACTTCAGGGTTAGTGCAGG - Intergenic
1070802763 10:79253314-79253336 GTGTACTTGTGAGTTTGTGCAGG + Intronic
1072145768 10:92635341-92635363 GCATACTTCAGAGATATTGCAGG + Intronic
1072325498 10:94294470-94294492 GCATACTTCGGAGATATTGCAGG + Intronic
1073979978 10:109143364-109143386 TCAAACTTCTGAGTTACTGCTGG + Intergenic
1075792536 10:125095329-125095351 GCTGCCTTCTGAGTTTGGGCTGG - Intronic
1079477202 11:20843429-20843451 CTTTACTTGTGATTTAGTGCTGG + Intronic
1081545757 11:44070547-44070569 GCTGACCCCTGAGTTACTGCAGG - Intronic
1084336822 11:68462702-68462724 GTTTATTTCTGACTGAGTGCAGG - Intronic
1091488788 12:915294-915316 CCTTACTGTTGAGTTATTGCAGG - Intronic
1092364791 12:7868428-7868450 GCATACCTCAGAGATAGTGCAGG - Intronic
1092411351 12:8255469-8255491 GGTAATTTCTGAGTTGGTGCTGG + Intergenic
1093690706 12:22105347-22105369 GCATACTTCAGAGATATTGCAGG + Intronic
1101620350 12:106380853-106380875 GCATACTTCGGAGATATTGCTGG + Intronic
1106287867 13:28333835-28333857 GGTTTCTTCTGAGCTCGTGCTGG + Intronic
1110011794 13:70345233-70345255 GGTTACTTTTGATTCAGTGCTGG - Intergenic
1112425478 13:99294908-99294930 GCTTACTTCCGAGTTGGAGATGG + Exonic
1113004613 13:105685655-105685677 GCTTCTTTCTCATTTAGTGCAGG + Intergenic
1113335296 13:109371056-109371078 CTTAACTTCTGAGTTAGCGCAGG - Intergenic
1113458088 13:110463157-110463179 GGTTCCTTCTGAGACAGTGCGGG + Intronic
1117932568 14:60858975-60858997 GCATACTTCGGAGATATTGCAGG - Intronic
1118037675 14:61885642-61885664 GCTTACTTTGGAGATATTGCAGG + Intergenic
1123769282 15:23512415-23512437 TCAGACTTCTGAGTTAATGCTGG - Intergenic
1124025402 15:25960906-25960928 CCTGACTTCTCAGTTATTGCAGG + Intergenic
1124994627 15:34711153-34711175 GTTCACTTCTGAGTAAGTTCAGG + Intergenic
1125039663 15:35170422-35170444 GCTTCCCTCTGAGTCAGAGCTGG + Intergenic
1127690939 15:61396765-61396787 CATTACTTCTGTGTTTGTGCTGG + Intergenic
1128824141 15:70694856-70694878 GTTTACTTCTGAGGTATTGTGGG - Intronic
1131262924 15:90898003-90898025 GCTGAGTTCTGAGGCAGTGCAGG + Intergenic
1133008007 16:2895299-2895321 CCTTGCGTCTGAGCTAGTGCTGG - Exonic
1136549125 16:30972964-30972986 GCTTCCTGCTGAGGTACTGCTGG + Intronic
1140660382 16:77185606-77185628 CCTTACTTCTTAGTTACTTCAGG + Intergenic
1144376429 17:14646765-14646787 TCTTATTTCTGATTTAGTACAGG + Intergenic
1149047934 17:52269313-52269335 GCTTGCCTCTGGGTTAGAGCTGG + Intergenic
1155843805 18:30680083-30680105 CCTTTCTTCTGAATGAGTGCAGG + Intergenic
1156379399 18:36544216-36544238 GCTCTCTGCAGAGTTAGTGCCGG + Intronic
1156632445 18:38985972-38985994 GTAGACTTCTGAGTTAATGCTGG + Intergenic
1157560657 18:48643461-48643483 CCTTCCTTCTGAGTTGGGGCAGG + Intronic
928555072 2:32415126-32415148 ATTTAGTTCTGAATTAGTGCAGG - Exonic
934066901 2:88349514-88349536 GTTTTCTTCTGAGTCAGGGCAGG - Intergenic
935366915 2:102303858-102303880 GCTAACTTCTCACTAAGTGCCGG - Intergenic
937597926 2:123692220-123692242 TCTGACTGCTGAGGTAGTGCTGG + Intergenic
938279926 2:130056575-130056597 TCTTACATTTGAGTTAATGCTGG - Intergenic
938330880 2:130447290-130447312 TCTTACATTTGAGTTAATGCTGG - Intergenic
938359066 2:130674213-130674235 TCTTACATTTGAGTTAATGCTGG + Intergenic
938364440 2:130723710-130723732 GCATACCTCAGAGATAGTGCAGG - Intergenic
945046135 2:205783588-205783610 GCTTCCTTCTGAGGAAGTTCAGG + Intronic
945728554 2:213504045-213504067 GCTATCTTGTGAGTTATTGCTGG + Intronic
945979786 2:216300019-216300041 GCTTACTTCGGAGTCAGTGTGGG + Intronic
946995563 2:225387339-225387361 GCTTCCTTCAGATTTATTGCTGG + Intergenic
1169361272 20:4951317-4951339 GCTTACTTCTGAGTTAGTGCTGG - Intronic
1173130363 20:40387362-40387384 GCCTAGTGCTGAGTTAGGGCAGG + Intergenic
1173935914 20:46864265-46864287 GCTCACTTCTGAGACATTGCTGG + Intergenic
1177053816 21:16274315-16274337 GCTTACTTCTGAGTTGTAGTTGG + Intergenic
1182618702 22:31605947-31605969 GCTTGCTGCTGAGTTAGCTCAGG - Intronic
1182945415 22:34316940-34316962 AGTTACTTTTGAGTTAATGCTGG + Intergenic
950979298 3:17284766-17284788 TTTTACTTCTGAGTAAATGCTGG - Intronic
951527545 3:23668334-23668356 GCTTAAGTCTGATTTAGAGCTGG + Intergenic
951655777 3:25006646-25006668 GGTTACTTCTGATTTAATGAAGG + Intergenic
952028730 3:29115104-29115126 CCTAACTTCTGAGATAATGCAGG + Intergenic
952432856 3:33241994-33242016 GCATACCTCTGAGATATTGCAGG + Intergenic
952775094 3:37038120-37038142 GCATACCTCTGAGATATTGCAGG - Intronic
953445860 3:42965873-42965895 GCATACTTCAGAGATACTGCAGG - Intronic
957082968 3:75653988-75654010 GTTTCCTTCTTAGTTAGTGATGG + Intergenic
957765647 3:84621216-84621238 TTTAACTTTTGAGTTAGTGCTGG - Intergenic
960563752 3:119113278-119113300 GTGGACTTCTGAGTTAATGCTGG - Intronic
960712607 3:120545920-120545942 GCTCACTACTGAATTATTGCTGG + Intergenic
962651111 3:137492405-137492427 CCTTGCTTCTGATTTTGTGCTGG - Intergenic
967280142 3:187814369-187814391 TGTTGCTTCTGAGTTTGTGCTGG - Intergenic
971086293 4:23279806-23279828 GCATACCTCTGAGATATTGCAGG - Intergenic
973003241 4:44977769-44977791 GCTTTCTTAAGAGTTAGGGCTGG - Intergenic
973719892 4:53712514-53712536 GCTTACTTCTGTGATAGTGAAGG + Intronic
976919179 4:90415917-90415939 CCTGACTTCTGTGTTAGTACTGG + Intronic
978336858 4:107678694-107678716 GCATGCTTGTGAGTGAGTGCAGG - Intronic
982841915 4:160199182-160199204 GCATACTTCAGAGGTATTGCAGG + Intergenic
983031428 4:162806947-162806969 GCATACCTCTGAGATAGTGCAGG + Intergenic
985607810 5:867838-867860 GTGGACTTCTGAGTTAATGCTGG + Intronic
985859958 5:2462891-2462913 GCTTCCTTGTGACTCAGTGCAGG - Intergenic
986545787 5:8895155-8895177 ACTTTCTTCTGTGTTAGTGATGG - Intergenic
990439498 5:55830584-55830606 GCTTACTTCCAAGTTAGTTGTGG + Intergenic
995678354 5:114688768-114688790 GCATACCTCTGAGATAGTGCAGG + Intergenic
996122807 5:119690836-119690858 GTGAACTTTTGAGTTAGTGCTGG - Intergenic
1000646727 5:163768613-163768635 GCTTAATTATGAGTTATTGCAGG + Intergenic
1004423228 6:15489730-15489752 TCTGTCCTCTGAGTTAGTGCAGG + Intronic
1005644041 6:27824538-27824560 GCTTGGTTCTGAGTCAGTTCTGG + Intergenic
1007196719 6:40067657-40067679 GTGGACTTCTGAGTTAATGCTGG + Intergenic
1007863959 6:44947262-44947284 GCATACTTCAGAGATATTGCAGG - Intronic
1008678972 6:53852193-53852215 GCATACTTCTAATTTAGTGGAGG - Intronic
1010674133 6:78721332-78721354 TCGGACTTCTGAGTTAATGCTGG + Intergenic
1011249112 6:85352025-85352047 GATAACATCTGAGTTTGTGCAGG - Intergenic
1018970698 6:168526654-168526676 GTTTATTTCTTAGTTGGTGCAGG + Intronic
1021991045 7:26142033-26142055 GCATACTTCTGAGGTCTTGCTGG + Intergenic
1022416519 7:30182420-30182442 GCCTACATCAGAGTTAGTGGGGG + Intergenic
1026417045 7:70192903-70192925 TCTTACTTCTGTGTGAGTTCTGG + Intronic
1028642385 7:93057487-93057509 GCATACCTCAGAGATAGTGCAGG + Intergenic
1028997311 7:97115783-97115805 GCTTACTACAGACCTAGTGCAGG + Intergenic
1029032751 7:97486092-97486114 GCAGAATTCTGAGTCAGTGCAGG + Intergenic
1030689572 7:112518592-112518614 GCTAACTTATTAGATAGTGCAGG + Intergenic
1031407112 7:121399153-121399175 GCTTGGTTCTGAGATAGTGAAGG - Intergenic
1034152167 7:148925583-148925605 GCTTCCTTCTGGGTTCTTGCAGG - Intergenic
1037996782 8:23358456-23358478 CCTTTCTTCTGCATTAGTGCTGG + Intronic
1041084054 8:54241100-54241122 GCCCACTGCTGAGTTAGTGCTGG + Intergenic
1041753201 8:61283925-61283947 ACTTACTTCTAAGTTATTGCAGG - Intronic
1042034681 8:64519041-64519063 TCTGTCTTCTGAGTTACTGCAGG + Intergenic
1042419798 8:68572869-68572891 GCTTATTTTTGTGTTAGAGCTGG + Intronic
1045045245 8:98268693-98268715 GCTTACCTCAGAGATATTGCAGG + Intronic
1048587117 8:135784454-135784476 GCTTGCTTTTGTGTTAGTGTTGG + Intergenic
1050390062 9:5133292-5133314 GGTTATTTCTGAGGTAGTGCTGG - Intronic
1050437037 9:5622092-5622114 GCATACTTCAGAGATATTGCAGG + Intergenic
1051564379 9:18480657-18480679 ACTTACTTATGAGTAAGTACTGG - Intronic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1055007803 9:71528485-71528507 ACTCAGTTCTGAGTTAGGGCTGG - Intergenic
1056585933 9:87927105-87927127 TTTTACTTTTGAGTTAATGCTGG - Intergenic
1056610951 9:88125838-88125860 TTTTACTTTTGAGTTAATGCTGG + Intergenic
1058309828 9:103486126-103486148 TTTTACTTTTGAGTTAATGCTGG + Intergenic
1058999960 9:110338117-110338139 GCTTACTTCTCATTTGGTGATGG - Intergenic
1062479287 9:136744031-136744053 GCTTTATTCTGAGCTGGTGCTGG + Exonic
1185752888 X:2628141-2628163 GTTTACTGCTGAGTAATTGCTGG + Intergenic
1186137754 X:6537141-6537163 ACTTACTGCTGAGTTATTGTTGG - Intergenic
1186298413 X:8173144-8173166 ACTTACTGCTGAGTTATTGTTGG - Intergenic
1186324376 X:8462772-8462794 ACTTACTGCTGAATTATTGCTGG + Intergenic
1187814789 X:23219389-23219411 GCATACTTCAGAGATATTGCAGG + Intergenic
1188387063 X:29574475-29574497 GCGGACTTTTGAGTTAATGCTGG - Intronic
1188469350 X:30520072-30520094 ACTTACTTCAGAGATATTGCAGG - Intergenic
1189431286 X:40949913-40949935 GTAGACTTCTGAGTTAATGCTGG - Intergenic
1189752770 X:44239397-44239419 GCTTCCATAAGAGTTAGTGCTGG - Intronic
1190269567 X:48852265-48852287 GTGGACTTCTGAGTTAATGCTGG - Intergenic
1194167742 X:90540981-90541003 GCATACCTCCGAGATAGTGCAGG + Intergenic
1194438685 X:93901763-93901785 TTAAACTTCTGAGTTAGTGCTGG + Intergenic
1199409510 X:147504569-147504591 GCATACTTCAGAGATATTGCAGG - Intergenic
1200353858 X:155527012-155527034 TTGAACTTCTGAGTTAGTGCTGG + Intronic
1200513994 Y:4118770-4118792 GCATACCTCCGAGATAGTGCAGG + Intergenic