ID: 1169363874

View in Genome Browser
Species Human (GRCh38)
Location 20:4975234-4975256
Sequence CTGCATTCCCAGAAGGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 1, 2: 3, 3: 26, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169363874_1169363877 -1 Left 1169363874 20:4975234-4975256 CCCAATTCCTTCTGGGAATGCAG 0: 1
1: 1
2: 3
3: 26
4: 272
Right 1169363877 20:4975256-4975278 GACAAACTGACAAAGCACAACGG 0: 1
1: 0
2: 1
3: 24
4: 287
1169363874_1169363878 25 Left 1169363874 20:4975234-4975256 CCCAATTCCTTCTGGGAATGCAG 0: 1
1: 1
2: 3
3: 26
4: 272
Right 1169363878 20:4975282-4975304 AAAACTATGTATTTCTTCATTGG 0: 1
1: 0
2: 3
3: 59
4: 526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169363874 Original CRISPR CTGCATTCCCAGAAGGAATT GGG (reversed) Intronic
900475865 1:2876065-2876087 CTGCATCCGCAGAGGGAGTTGGG + Intergenic
905256838 1:36690199-36690221 CTAGATTCACAGAAGGAAATAGG + Intergenic
906100073 1:43254557-43254579 CTGCATTTCCTGAAGGAGATAGG - Intronic
906131160 1:43457933-43457955 CTGCCTTCATAGAATGAATTAGG - Intergenic
907147751 1:52251699-52251721 CTGGCTTCACAGAAGGAGTTAGG + Intronic
908443472 1:64178507-64178529 CTGCATATCCAGGAGGTATTGGG - Exonic
910236280 1:85039575-85039597 CTGCATTTCCAGAAGGAATGTGG + Intronic
910507577 1:87967683-87967705 CTTCATTCCCAGTAGGTAGTAGG + Intergenic
913297146 1:117333141-117333163 CTGCATTACTAGCAGGGATTTGG - Intergenic
914755114 1:150558009-150558031 CTGCAGTGCCGGCAGGAATTTGG + Exonic
914941282 1:152024993-152025015 CTGTGTTCCCAGAAGGCATGGGG - Intergenic
915442522 1:155954228-155954250 CTTTAATCCCAGAAGGATTTGGG - Intronic
916315565 1:163444366-163444388 TTGACTTCCCAGAAGGAATTAGG - Intergenic
917412236 1:174771015-174771037 CTAGTTTCCCAGAATGAATTTGG - Intronic
917898172 1:179513569-179513591 CTGCCTTCATAGAATGAATTAGG + Intronic
918873772 1:190011524-190011546 CTGGCTTCACAGAATGAATTAGG - Intergenic
919155069 1:193753913-193753935 CTGCATTGCCGGTGGGAATTGGG - Intergenic
919298866 1:195735419-195735441 TTGCTTTCCCAGGAGGAATGGGG - Intergenic
921775534 1:219096052-219096074 CTGCAATTCAAGAAGAAATTTGG - Intergenic
922965029 1:229682547-229682569 CTGCATTCCAAGAATGAATGGGG - Intergenic
924149541 1:241114522-241114544 CTGCATTCCCAAGAAGAATCTGG + Intronic
1064201001 10:13284836-13284858 CGTCATTCCCAGAAGGAACTGGG - Intronic
1064532317 10:16322982-16323004 CCTCATTCACAGAGGGAATTTGG + Intergenic
1065237126 10:23664223-23664245 CTGCCCTCACAGAAGGAATTTGG - Intergenic
1065355563 10:24837407-24837429 CTGGCTTCACAGAATGAATTAGG - Intergenic
1065815740 10:29480964-29480986 CTGCATTTCCAGAAAGACTCTGG + Intronic
1066197679 10:33116977-33116999 CTGCAGCCCAAGAAGGAGTTAGG + Intergenic
1066197702 10:33117143-33117165 CTGCAGCCCAAGAAGGAGTTAGG + Intergenic
1066207679 10:33205756-33205778 CATTATTCCCAGAAGCAATTTGG + Intronic
1067282864 10:44886057-44886079 CTGCATTCACAGAACGCCTTTGG - Intergenic
1068009038 10:51424894-51424916 CTGTATTACCATAAGGAATGCGG + Intronic
1068481062 10:57588913-57588935 CTGGCTTCACAGAATGAATTAGG - Intergenic
1069082261 10:64100995-64101017 CTATAATCCCAGAAGGGATTGGG - Intergenic
1069833121 10:71293258-71293280 CTGCATTCCCAGAGGTCATGGGG - Intronic
1073456965 10:103643198-103643220 CTCCTTTCCCAGTTGGAATTTGG + Intronic
1074153126 10:110776163-110776185 CTACATTCCCAGAGGGTCTTTGG + Intronic
1074985520 10:118655569-118655591 CTGGCTTCACAGAATGAATTAGG + Intergenic
1077089795 11:773227-773249 AGGCTTTCCCAGAAGGAATCAGG + Intronic
1079122162 11:17693922-17693944 CTTCATTTCCAGAAAGAATAAGG + Intergenic
1083841282 11:65305734-65305756 ATACATTCCCAGAAGGGACTTGG - Intergenic
1085163648 11:74374483-74374505 CTGCAGTCCCAAAAGTCATTCGG + Exonic
1085252343 11:75152178-75152200 CTGCCTTCCCAGAAAGTGTTGGG - Intronic
1085611699 11:77956034-77956056 CTTCATTAGAAGAAGGAATTGGG + Exonic
1085770516 11:79321524-79321546 TTTCCTTCCCAGAAAGAATTGGG - Intronic
1085789688 11:79486277-79486299 CAGCATCCCCAGAAGTAATCTGG + Intergenic
1088206733 11:107400701-107400723 CTGGCTTCACAGAATGAATTAGG - Intronic
1088800355 11:113300612-113300634 CTGCCTTCCTAGAATGATTTAGG - Intergenic
1090101475 11:123801780-123801802 CTGTATTCAAAGAAGAAATTAGG - Intergenic
1090397538 11:126429121-126429143 CTCCATTCCCAGAAGGTCCTGGG - Intronic
1090437044 11:126695713-126695735 CTGCATTGCAAGAAGGAGCTGGG + Intronic
1090757600 11:129806945-129806967 CTGGCTTCACAGAATGAATTAGG - Intergenic
1091911024 12:4230780-4230802 CTGAGGTCCCAGAAGCAATTCGG - Intergenic
1092079614 12:5704607-5704629 CTGTCTTCCCTGAAGGCATTTGG + Intronic
1093779609 12:23120484-23120506 CTGAATTCCCACAAGGAGCTGGG - Intergenic
1094659339 12:32451644-32451666 CTGTAATCCCAGGAGGGATTTGG + Intronic
1095733052 12:45526098-45526120 CTGCCTTCATAGAATGAATTAGG - Intergenic
1095895157 12:47272724-47272746 GTTCATTCCCAAAAGGATTTAGG - Intergenic
1096214148 12:49790308-49790330 CTCCTTCCCCAGAAGGAAATAGG + Intergenic
1098714506 12:73812838-73812860 CTTCATTCTCTGAAGGAACTAGG + Intergenic
1099398704 12:82175100-82175122 CTTCATTCCCAAAAGGCAGTTGG - Intergenic
1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG + Intergenic
1100537088 12:95521604-95521626 CTGCAGTCCCAGCAGGAAAATGG - Intronic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1101810734 12:108105573-108105595 CTGTATTCCCAGAATGAAGCAGG - Intergenic
1103091669 12:118102491-118102513 CTGCTTTCCCAGTTGGAATTGGG - Intronic
1103106995 12:118237127-118237149 CTTAATTCCCAGCAGGATTTCGG + Intronic
1104698326 12:130881555-130881577 CTGTATTCCCAGCAGCACTTTGG + Intergenic
1104982017 12:132577373-132577395 CCGCTTTCCCAGGAGGAGTTTGG + Intronic
1107755684 13:43619756-43619778 CTGGCTTCACAGAATGAATTAGG + Intronic
1108825857 13:54411431-54411453 CTGGCTTCACAGAATGAATTAGG - Intergenic
1109032328 13:57207707-57207729 CTGCATTCTCAGAAAGAGTTAGG + Intergenic
1109508083 13:63333405-63333427 CTGGCTTCACAGAATGAATTAGG + Intergenic
1111424174 13:88057994-88058016 CTGCAATTCAAGATGGAATTTGG - Intergenic
1112296689 13:98193722-98193744 CTGGATTTCCACAAGGCATTTGG - Intronic
1117475459 14:56090164-56090186 ATGGATTCTCAGCAGGAATTGGG - Intergenic
1118012344 14:61622737-61622759 CTCCATTACCAGAAAGGATTTGG - Intronic
1118587893 14:67373074-67373096 CTGCATTCCCATGAGCAATGTGG - Intronic
1119214263 14:72856530-72856552 CTGCATTCCAAGAATGCATGGGG + Intronic
1120528297 14:85603204-85603226 CTGAATTCCCTGAAGGTACTTGG + Intronic
1121660882 14:95634126-95634148 CTGAATTCCCAGATGGAACCTGG + Intergenic
1121762950 14:96461121-96461143 CTGCCTTCCCATAAGACATTTGG + Intronic
1121920409 14:97875624-97875646 CTGCATTTGCAGAATGAATAGGG - Intergenic
1122372207 14:101234938-101234960 CTGCATTCCGAGAGGGCATTTGG + Intergenic
1122547516 14:102532262-102532284 CTGCATTCCCAGAAGTGAGAAGG + Intergenic
1124386455 15:29211981-29212003 CTGGCTTCACAGAATGAATTAGG + Intronic
1125009891 15:34859941-34859963 CTGATTTCCCACAAGGAATTAGG + Intronic
1125273161 15:37962543-37962565 CTGGCTTCACAGAATGAATTGGG + Intronic
1125975747 15:43950039-43950061 CTGCATACCAAGAAGGAAGAAGG - Intronic
1126730504 15:51677171-51677193 ATGGCTTCCCAGAAGGAATCAGG - Intergenic
1128853263 15:70984236-70984258 CTGCATTCCCAGAGGAAACAGGG + Exonic
1131693451 15:94851053-94851075 CTGCCTTCATAGAATGAATTAGG + Intergenic
1135729490 16:24882415-24882437 CTTCCTTCCCAGCAGGAATAGGG - Intronic
1135875760 16:26198596-26198618 CTGCATTCCCAGAATGAAGTCGG + Intergenic
1136711617 16:32241443-32241465 CCGCACTCCAAGAAGGAATCGGG + Intergenic
1136756300 16:32687963-32687985 CCGCACTCCAAGAAGGAATCCGG - Intergenic
1136811813 16:33182412-33182434 CCGCACTCCAAGAAGGAATCCGG + Intergenic
1136818289 16:33292492-33292514 CCGCACTCCAAGAAGGAATCCGG + Intronic
1136824853 16:33349025-33349047 CCGCACTCCAAGAAGGAATCCGG + Intergenic
1136829919 16:33447796-33447818 CCGCACTCCAAGAAGGAATCCGG + Intergenic
1141026100 16:80550081-80550103 CTCCTTTCCCTGAAGGAATTAGG + Intronic
1141157945 16:81610100-81610122 CTCCAGCCCCAGAAGGAATGAGG - Intronic
1202990391 16_KI270728v1_random:5380-5402 CCGCACTCCAAGAAGGAATCCGG + Intergenic
1203058437 16_KI270728v1_random:948316-948338 CCGCACTCCAAGAAGGAATCGGG - Intergenic
1143744156 17:8978289-8978311 TTACATTCCCACAAGGAAATAGG - Intergenic
1144668527 17:17118329-17118351 CTGCAACCCCAGAGGGACTTTGG - Intronic
1144668639 17:17118859-17118881 CTGCAGCCCCAGAGGGACTTTGG + Intronic
1145399349 17:22518382-22518404 CTGTATTCCCAGCAGCACTTTGG + Intergenic
1146134435 17:30306143-30306165 CAGCATTCCCAGAAGGAAACTGG - Intergenic
1146583228 17:34058701-34058723 CTGCATTCCCACAAAGAAAACGG - Intronic
1149150772 17:53561209-53561231 ATGCATGCCCAGAAGGCATTAGG + Intergenic
1153443398 18:5146237-5146259 CTGCATTTCCTGAAGGAAGTGGG - Intronic
1154054795 18:11002578-11002600 CACCATTTCCAGAAGGAAATTGG + Intronic
1155923277 18:31627026-31627048 CCCCATCCCCAGAAGGCATTAGG + Exonic
1156582822 18:38397238-38397260 ATGCATTCCCAGAATGATTTGGG - Intergenic
1159659299 18:71074366-71074388 CTGAAATACCAGAAGTAATTGGG - Intergenic
1159918399 18:74205519-74205541 CTGCTTTCCCAGATGCAATCAGG + Intergenic
1160979422 19:1810101-1810123 CTGCATGCCCAGAAAGATCTGGG - Intronic
1163250568 19:16124252-16124274 CTGAATTCCCAGGAGGATTTGGG + Intronic
1163988611 19:20976465-20976487 CTACATTACCATAAGAAATTTGG + Intergenic
1164298914 19:23941483-23941505 CTGGCTTCACAGAATGAATTAGG + Intronic
1164976109 19:32573959-32573981 CTGTAATCCCAGCAGGGATTTGG + Intergenic
1165265090 19:34655228-34655250 CTGAATTCCAAAAGGGAATTGGG - Intronic
1167194409 19:48017631-48017653 CTGTAATCCCAAAAGGGATTGGG + Intronic
925024063 2:594262-594284 CTTACTTCGCAGAAGGAATTCGG - Intergenic
925567951 2:5276991-5277013 CTGCATTCGCAGATGGTGTTAGG - Intergenic
926642939 2:15257054-15257076 CTGGCTTCCCAGAATGATTTAGG + Intronic
926881018 2:17543347-17543369 CTGGATTCCCTGAAGGATTTTGG - Intronic
927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG + Intergenic
928188594 2:29139486-29139508 CTGCTTTCATAGAATGAATTAGG + Intronic
928734009 2:34264629-34264651 CTGGCTTCACAGAATGAATTAGG - Intergenic
929517229 2:42614850-42614872 CTGTATTCCCAGAAGTATTTGGG + Intronic
929834718 2:45384900-45384922 CTGCATTCCAAGCAGGAAGGAGG + Intergenic
931835691 2:66096393-66096415 GTTTATTGCCAGAAGGAATTTGG + Intergenic
932270615 2:70405824-70405846 CTGGATTCATAGAATGAATTAGG - Intergenic
933971846 2:87476066-87476088 CTGCACTCCCAGATAGTATTAGG + Intergenic
934657748 2:96124834-96124856 CTGCATGCGCAGGAGGAACTGGG - Intronic
936321881 2:111474135-111474157 CTGCACTCCCAGATAGTATTAGG - Intergenic
936598652 2:113874048-113874070 AACCATGCCCAGAAGGAATTAGG - Intergenic
937200765 2:120203344-120203366 CTGCATTCCCAGAGTGACTTTGG + Intergenic
938969175 2:136416578-136416600 GTGCATTCCCTGTAGGAATTTGG + Intergenic
939646560 2:144706665-144706687 CTGCATTCACAATAGAAATTTGG - Intergenic
939757061 2:146127664-146127686 CTGCTTTCCTATAAGGAATATGG + Intergenic
942187266 2:173436266-173436288 CTCCATTGCCAGAAGGAAACAGG + Intergenic
943392111 2:187283324-187283346 CTGGATTCATAGAATGAATTTGG + Intergenic
944262789 2:197695338-197695360 CTGCCTTCACAGAACGATTTAGG + Intronic
945037037 2:205713043-205713065 CAGCATTACAAGAAGGGATTTGG + Intronic
945266717 2:207898101-207898123 CTGAATTACGAGAAGGAATTTGG - Intronic
946625090 2:221603123-221603145 CTGCATTCCTATCATGAATTGGG - Intergenic
947017327 2:225635730-225635752 CTGCATTTATAGATGGAATTTGG + Intronic
947456761 2:230261958-230261980 CTGGCTTCACAGAATGAATTAGG + Intronic
948194762 2:236087145-236087167 TTGGATTCCCAGAAGCAAATGGG - Intronic
948251396 2:236532876-236532898 TTACATTACCAAAAGGAATTAGG - Intergenic
1169363874 20:4975234-4975256 CTGCATTCCCAGAAGGAATTGGG - Intronic
1169648972 20:7845682-7845704 CTGCATTCCAAGGATGGATTGGG + Intergenic
1169656536 20:7930321-7930343 CATCATTCCCAGAAAGAATATGG - Intronic
1170558896 20:17538929-17538951 GTGTATTCCCAGAAGGAAACGGG - Intronic
1172004786 20:31811627-31811649 CTCCATTCCCAGAATGAAGACGG + Intergenic
1172362237 20:34321278-34321300 CTGCATTCCCAGATGGTTTAAGG + Intergenic
1177847622 21:26309184-26309206 CTGGCTTCACAGAATGAATTAGG - Intergenic
1177891387 21:26808159-26808181 TTGAAGTCCCAGAAGGAATCTGG + Intergenic
1178031545 21:28532792-28532814 CTGGACTCACAGAATGAATTAGG + Intergenic
1182004391 22:26947213-26947235 CTGGAATCCAAGAAGGAAATTGG + Intergenic
1185379736 22:50502913-50502935 CTGCTTTCCCAGGAGGCATGAGG - Intergenic
950856813 3:16113488-16113510 CTGCATTTCCAGATGGGTTTTGG - Intergenic
951672069 3:25195712-25195734 CTTCATTCCCAGAATGAAAAGGG + Intronic
952014408 3:28939828-28939850 CTGCAATCCCAGCAGCACTTTGG - Intergenic
952429367 3:33207123-33207145 CTGATTTCCCAATAGGAATTTGG + Intronic
953522669 3:43657845-43657867 CTGCTTTCAAAGATGGAATTTGG - Intronic
955343458 3:58143480-58143502 CTGTCTTCCCAGAAGGCATGTGG - Exonic
956562454 3:70595297-70595319 CTGCATTCCCAAAAGGACTTTGG - Intergenic
957524618 3:81363759-81363781 CTAGAATCCCAGAAGGAATTTGG + Intergenic
959545271 3:107588501-107588523 TTGCACTCACAGAAGCAATTTGG + Intronic
959705663 3:109336752-109336774 CTGCAGTCCCAGTAGCACTTTGG + Intronic
959899408 3:111642957-111642979 CTGGCTTCACAGAATGAATTAGG - Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960231067 3:115228306-115228328 CTACAGTTCCAGAAGGGATTTGG - Intergenic
960954770 3:123024487-123024509 CTGGATTCCCAGTGGGAATGGGG + Intronic
962122361 3:132575412-132575434 TTGGTTTCCTAGAAGGAATTAGG - Intronic
964624746 3:158748330-158748352 CTGCATTCCAGGAAGGAATAAGG - Intronic
966020600 3:175204081-175204103 CTGGCTTCACAGAATGAATTAGG - Intronic
966049264 3:175593730-175593752 CTGCATCCTTAGAAGAAATTTGG - Intronic
969073527 4:4558755-4558777 CAGCATCCCTAGGAGGAATTTGG + Intergenic
970618966 4:17797448-17797470 CTGCATTCAAAGAAGGAAACTGG + Intergenic
972284122 4:37631817-37631839 CTGCAATCCCAGCAGCACTTTGG + Intronic
973918357 4:55659439-55659461 ATAGATTCTCAGAAGGAATTTGG - Intergenic
974095359 4:57357837-57357859 CTGCTTTCTGAGAAGGAAATGGG - Intergenic
974180332 4:58376275-58376297 CTGGTTTCACAGAATGAATTAGG + Intergenic
974369712 4:60999650-60999672 TTCCATTCCCAGAAAGAAGTTGG - Intergenic
976594176 4:86878945-86878967 ATGCATTCCCAGAAAGGTTTGGG + Intronic
977110709 4:92950569-92950591 CTTCAGTCCCAGAAGAAACTGGG + Intronic
977935795 4:102803320-102803342 TTGCATACCCAGAAGCAGTTAGG - Intronic
978114730 4:105005624-105005646 CTGGAATCCCAGAAGGAAAGAGG - Intergenic
978537852 4:109781645-109781667 CTGGCTTCACAGAATGAATTGGG - Intronic
978559025 4:110011772-110011794 CTGCAGCCCCAGAAGAAATTAGG + Exonic
978884132 4:113745824-113745846 CTGAAATCCCAGAAGGATTAGGG - Intronic
980152910 4:129070261-129070283 CTGGCTTCACAGAATGAATTAGG + Intronic
980985710 4:139692350-139692372 CTGTATTCCCAGAAGGAATTGGG - Intronic
982630936 4:157828210-157828232 CTGGCTTCACAGAATGAATTAGG - Intergenic
983776931 4:171619820-171619842 CAGCATTCATAGAATGAATTAGG - Intergenic
985478158 5:91470-91492 CTGAATTCCCAGCAGGAAGCTGG + Intergenic
986399061 5:7361694-7361716 CTTCATTTTCAGAAGGACTTAGG - Intergenic
986475688 5:8129315-8129337 CTGGATGGCCAGAAAGAATTGGG - Intergenic
987362995 5:17123360-17123382 CTCCATTCCCAGATGAAACTTGG - Intronic
989403894 5:41039135-41039157 CTGCTTTCCCTGAAGGAAAGGGG - Intronic
989952888 5:50321653-50321675 CTGCATCACCAGAATGAATCGGG + Intergenic
996390281 5:122952943-122952965 CTGGAGTCCCAGAAGGAAAGGGG + Intronic
996908094 5:128624968-128624990 CTGAATTCCCAGCATGACTTTGG + Intronic
997680895 5:135749955-135749977 CTGCTTGCCCAGGAGGAAGTGGG - Intergenic
998060861 5:139117840-139117862 CTGCAGTCCAGGTAGGAATTGGG - Intronic
998667745 5:144317624-144317646 ATGCATTCCTAGAAGAAATAAGG - Intronic
999490865 5:152049888-152049910 CTGCCTTCACAGAATGATTTAGG + Intergenic
999520893 5:152349677-152349699 CTTCAGTCCCAGAAAGAAATGGG + Intergenic
1000018295 5:157297568-157297590 CTGCCTTCCCAAAAAGATTTTGG - Intronic
1000605037 5:163318806-163318828 CTGAATACCCGGAAGGAACTGGG - Intergenic
1003264924 6:4557204-4557226 CTGCAGACCCAGGAGGAGTTGGG - Intergenic
1004820606 6:19364285-19364307 CCTCAATCCCAGAAGGGATTTGG + Intergenic
1005940616 6:30556814-30556836 CATCGTTCCCACAAGGAATTTGG - Exonic
1006050223 6:31336525-31336547 CTGCTTTCCCAGAGGAAATTAGG + Intronic
1006509087 6:34512155-34512177 CTTCATTCCCAGCAGCAGTTGGG + Intronic
1008807528 6:55450006-55450028 CTGAGTTCCCTGAAGGAACTTGG + Intronic
1009515274 6:64608455-64608477 TTGCATTCGCACAAGAAATTAGG - Intronic
1010801053 6:80176099-80176121 CTGGATTAGCAGAAGGAAATGGG + Intronic
1011708414 6:90026572-90026594 CCCCATTCCAAGAAGGAGTTAGG - Intronic
1012341233 6:98126896-98126918 TTGCATTCTCAGGAGGACTTAGG + Intergenic
1013317040 6:108953168-108953190 CTGCATTCCCAGAAGCCGGTGGG + Exonic
1014285344 6:119490803-119490825 CTGGATTCATAGAATGAATTAGG - Intergenic
1014327856 6:120021431-120021453 TTGCCATCCCAGAAGGTATTAGG - Intergenic
1014330480 6:120057753-120057775 CTGGCTTCACAGAATGAATTTGG - Intergenic
1016165084 6:140931796-140931818 TTGTATTTCAAGAAGGAATTTGG + Intergenic
1016887817 6:148974530-148974552 CTGCTTTCCCAGAAAGAACATGG - Intronic
1017358006 6:153532844-153532866 CTGGCTTCCCAGAATGAGTTAGG + Intergenic
1023600338 7:41876112-41876134 AAGATTTCCCAGAAGGAATTGGG + Intergenic
1023701571 7:42896726-42896748 CTGGCTTCACAGAATGAATTAGG - Intergenic
1023977739 7:45043790-45043812 AAACATTCCCAGAAGGCATTGGG - Intronic
1024395520 7:48862309-48862331 CTGCATTCCAAGCAGGAAGAAGG + Intergenic
1024399712 7:48909968-48909990 CTGCATTCCAAGCAGGAAGAAGG - Intergenic
1024452760 7:49566703-49566725 CTGGATTCACAGAATGAGTTAGG - Intergenic
1025841392 7:65153023-65153045 CTTCATTAGAAGAAGGAATTGGG - Intergenic
1025881655 7:65542946-65542968 CTTCATTAGAAGAAGGAATTGGG + Intergenic
1025891786 7:65659686-65659708 CTTCATTAGAAGAAGGAATTGGG - Intergenic
1026473149 7:70711357-70711379 GTGCAGCCCCAGAAGCAATTAGG - Intronic
1027699530 7:81452538-81452560 CTGGCTTCCTAGAATGAATTAGG - Intergenic
1029205778 7:98868841-98868863 CTGTATTTCCAGGAGGAAATAGG + Intronic
1029424463 7:100487298-100487320 TTCCATTCTCAAAAGGAATTGGG + Intronic
1031818032 7:126463691-126463713 CAGCATTTCCAAAAGGAAGTTGG + Intronic
1032672154 7:134094550-134094572 CTGGATTCACAGAATGAGTTAGG - Intergenic
1033345940 7:140525859-140525881 CTGCATGCCAAGAAGGAAGAAGG - Intronic
1034050500 7:147978910-147978932 CAGCCTCCCCAGGAGGAATTGGG - Intronic
1035312520 7:157978709-157978731 GTGCAGTCCCAGAGGGAAGTGGG - Intronic
1038366946 8:26946121-26946143 CTGGCTTCATAGAAGGAATTAGG + Intergenic
1038825429 8:30994301-30994323 ATGCTTTCCCATAAGGATTTAGG + Intergenic
1039733706 8:40307082-40307104 CTTCATTTTCATAAGGAATTTGG + Intergenic
1040680542 8:49803217-49803239 CCCCATACCCAGAAGGAATGAGG - Intergenic
1042122521 8:65503887-65503909 CTGACTTCACAGAATGAATTAGG + Intergenic
1043121374 8:76329439-76329461 CTGGCTTCACAGAATGAATTAGG + Intergenic
1044726733 8:95200513-95200535 CTGCTTTCCCACAAGTAAGTTGG - Intergenic
1045183319 8:99810432-99810454 CTGCATGCCAAGGAGGAATCAGG + Intronic
1046152752 8:110249749-110249771 CTGCATTCCCAGATGAATTTAGG + Intergenic
1046302152 8:112309510-112309532 CTGATTTCCCAGAATTAATTTGG - Intronic
1046735631 8:117773511-117773533 CTGCATTAACAGAAAGCATTAGG + Intergenic
1047618525 8:126583022-126583044 CTCCATTACCAGCAGGTATTGGG - Intergenic
1048040898 8:130727638-130727660 CTTCATTCCAAGAAGGAAGGTGG + Intergenic
1050651105 9:7777864-7777886 CTGCTTCCCCAGAAAGAAGTGGG - Intergenic
1050891247 9:10827295-10827317 CTGGCTTCACAGAAGGATTTGGG + Intergenic
1051257551 9:15230722-15230744 CTGTAATCCCAGCAGGACTTTGG + Intronic
1051732566 9:20161847-20161869 CTACATTCCCAATAGGAGTTGGG + Intergenic
1051881444 9:21844365-21844387 CTGGCTTCACAGAATGAATTAGG - Intronic
1052155652 9:25186913-25186935 CTGCCTTCACAGAATAAATTAGG - Intergenic
1052201591 9:25788391-25788413 CTGCATTCACTGAAGAACTTAGG - Intergenic
1055596428 9:77869774-77869796 AGGCATTCCCAGAAGGAGATGGG - Intronic
1055956961 9:81783016-81783038 CTATAATCCCAGAAGGATTTTGG - Intergenic
1056322430 9:85448895-85448917 CTGGCTTCACAGAATGAATTAGG + Intergenic
1056673685 9:88654650-88654672 CTGCATTCCAAGCAGGAAGACGG - Intergenic
1056731428 9:89169564-89169586 CTTCATGTCTAGAAGGAATTTGG + Intronic
1056759000 9:89401763-89401785 CTGCATTTCCCAAAGGAAATGGG + Intronic
1057828268 9:98387849-98387871 CTGCTTGCAAAGAAGGAATTTGG - Intronic
1058198760 9:102012000-102012022 CTGGATTCCTAGAATGAGTTAGG - Intergenic
1058622890 9:106902425-106902447 CTGGATTCATAGAATGAATTAGG + Intronic
1058631287 9:106989543-106989565 CTGGCTTCCCAGAATGAATTAGG + Intronic
1059260450 9:112971049-112971071 CTGCTTTCCCAGAAGAAAAATGG - Intergenic
1059319076 9:113452614-113452636 CTGGAATCCCAGAAGAAAGTAGG - Intronic
1059691004 9:116686521-116686543 CTGCAGTCCCTGAAGTAGTTTGG - Intronic
1059737755 9:117119339-117119361 CTGCAAACTCAGAAGCAATTGGG - Intronic
1060955046 9:127632794-127632816 CTGCATTCCAGGAAGGAAGGAGG + Intronic
1060984840 9:127813968-127813990 CTCCCTTCCCAGAAGGCACTGGG - Exonic
1061149371 9:128820263-128820285 CTGTCTTCCCAGAAGGAAGCTGG - Exonic
1061327564 9:129873606-129873628 CTGCCTTCCCAGAAGGGAGCCGG + Intronic
1188225230 X:27589370-27589392 ATGCATTGCAAGAAAGAATTTGG + Intergenic
1188469743 X:30524938-30524960 CTGCAATCCCAGGCCGAATTGGG + Intergenic
1189878854 X:45467987-45468009 CTGGCTTCACAGAATGAATTAGG + Intergenic
1191820447 X:65300434-65300456 TTGCATTCCCAGAAGGATTATGG - Intergenic
1192740207 X:73885082-73885104 CTGGATTCATAGAATGAATTAGG - Intergenic
1192944059 X:75945847-75945869 CTGGATTCATAGAATGAATTAGG + Intergenic
1194557178 X:95374559-95374581 CTGGCTTCACAGAATGAATTAGG - Intergenic
1194900704 X:99507425-99507447 CTGCATTCCCACAAGTAAAATGG + Intergenic
1196022528 X:111005423-111005445 TTGCATTTCCTGAATGAATTTGG - Intronic
1197145184 X:123164291-123164313 CTGGATTCATAGAAGGATTTAGG - Intergenic
1197568978 X:128125959-128125981 CTGCATTTTCAGAATTAATTTGG - Intergenic
1198736797 X:139794690-139794712 CTGCATTCCCATAGGTAATATGG + Intronic
1199295191 X:146149208-146149230 CTCCATCCCCATAAGGAACTGGG - Intergenic
1201677747 Y:16605960-16605982 CTGGAATCCCAGAAGGAAAGGGG + Intergenic
1202298605 Y:23386555-23386577 CAGCATTGCCAGAGGGAAATGGG - Intergenic
1202572203 Y:26284044-26284066 CAGCATTGCCAGAGGGAAATGGG + Intergenic