ID: 1169366717

View in Genome Browser
Species Human (GRCh38)
Location 20:4998513-4998535
Sequence CAGCTTAACCTGGAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169366713_1169366717 -5 Left 1169366713 20:4998495-4998517 CCTAGAGGCTGCAATGCACAGCT 0: 1
1: 0
2: 1
3: 8
4: 194
Right 1169366717 20:4998513-4998535 CAGCTTAACCTGGAGGAGGATGG 0: 1
1: 0
2: 1
3: 19
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169366717 Original CRISPR CAGCTTAACCTGGAGGAGGA TGG Intronic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
901689195 1:10961394-10961416 CTTCTTAACCTGAAGGAGCAGGG - Intronic
902095273 1:13938899-13938921 CAGCTAGAGCTGGAGCAGGAGGG + Intergenic
902625318 1:17673093-17673115 AAGCCTGACCTGGAGCAGGAGGG + Intronic
902702277 1:18180608-18180630 ATGCTGAACCTGGAGTAGGAAGG - Intronic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903475029 1:23613551-23613573 CAGCTGAACCTGGAGGACTCAGG - Intronic
904004591 1:27357106-27357128 CTGCTTCACCTGCAGGGGGAGGG + Exonic
905218301 1:36425963-36425985 GAGCTGAGCCTGGAGGAAGAAGG + Intronic
905523203 1:38615945-38615967 CTGCTTCACCTAAAGGAGGATGG + Intergenic
905789470 1:40782718-40782740 CAGCTTTCCGTGGAGGAAGAGGG + Intergenic
907309493 1:53531149-53531171 CAGGTGACCCTTGAGGAGGAAGG + Intronic
908996632 1:70163467-70163489 TGGCTTAACTTGGAGGAGGAAGG - Intronic
910053473 1:83004151-83004173 CAACCAAACCTGGAGGAAGAAGG + Intergenic
910795112 1:91090268-91090290 CACCTTAACCTTGAGGTGTAGGG - Intergenic
912694070 1:111827801-111827823 CAGGGTATCCTGGAGCAGGAGGG - Intronic
913547928 1:119887808-119887830 CAGCTTCACCTAGGGGAGGGAGG + Intergenic
914228728 1:145744933-145744955 CAGCTTGGCCTGGAAGAGGTAGG - Exonic
914807415 1:151001774-151001796 GAGCTTCACCTGGAGGCAGAAGG + Exonic
915497537 1:156292525-156292547 CAGCTCTACCTGGTGGAGCAGGG + Intronic
915550168 1:156627806-156627828 CAGCTCAGCCAGCAGGAGGATGG + Intergenic
915584773 1:156838491-156838513 CAGGTTGACCTGGAGAAGGAAGG - Intronic
915838084 1:159193938-159193960 CAGGTTACCCGGGAGGATGATGG + Exonic
917473741 1:175350186-175350208 CAGCTCAGCCTGGATGTGGAAGG + Intronic
918148567 1:181779361-181779383 CAGCTTAGCCATGAAGAGGATGG - Intronic
919635029 1:199995749-199995771 CAGCTGAACCTATGGGAGGAAGG - Intergenic
920572940 1:207031659-207031681 CAGATTTACCTGCAGAAGGAAGG - Intronic
921133447 1:212239343-212239365 TAGTTTAACCTGGAGGGTGAAGG - Intergenic
1064138782 10:12772733-12772755 CAGGTTGTCCTGGAGGAGGCTGG + Intronic
1064559149 10:16578675-16578697 CAGAATAACATGGAGGAGGCAGG - Intergenic
1064888610 10:20141450-20141472 CTGCTTAACTTGGAGGATGGAGG - Intronic
1065022857 10:21515383-21515405 CAGTTTTACCTGTAGGACGAGGG + Exonic
1065140381 10:22714102-22714124 CAGCTGCAGCCGGAGGAGGAGGG + Intronic
1070237704 10:74647207-74647229 CAGATTAAATTGGAGAAGGAAGG + Intronic
1072748695 10:97960362-97960384 CAGTTTGACTTGGAGGAGGCTGG - Intronic
1075737600 10:124673614-124673636 CAGCTCAGCCTGGATTAGGAAGG - Intronic
1076232697 10:128835012-128835034 CATTTTACCCTGGAAGAGGAAGG + Intergenic
1076721547 10:132395555-132395577 CAGCCCAACCTGGAGCAGGGTGG + Intergenic
1076737951 10:132467096-132467118 CAGCTGGCCCTGGAGGTGGATGG + Intergenic
1077343168 11:2035040-2035062 GTGCTTCAGCTGGAGGAGGAAGG - Intergenic
1077485732 11:2837646-2837668 CAGCCAAACCAGGAGGGGGAAGG + Intronic
1078370688 11:10742211-10742233 CAGCTTTCCCTGCATGAGGAAGG + Intergenic
1078451129 11:11441782-11441804 TAGCTGGCCCTGGAGGAGGAGGG - Intronic
1079683712 11:23330263-23330285 AAGCTAAACCTGGAAGTGGAAGG - Intergenic
1080042603 11:27774715-27774737 GAAGTTAACCTGGAGGAAGATGG + Intergenic
1080674079 11:34408610-34408632 CAGATTAGAATGGAGGAGGATGG + Intergenic
1081537411 11:44005720-44005742 CAGCTTTACCTGGGGGTAGAGGG - Intergenic
1081694911 11:45102963-45102985 CTGTTTACCCTGGAGGGGGAAGG + Intronic
1082772261 11:57217205-57217227 CTGCTTCCCCAGGAGGAGGAAGG - Intergenic
1083095408 11:60245596-60245618 CACCTTAGTCTGGAGAAGGAAGG + Intergenic
1083314040 11:61803165-61803187 CAGCTTTACCTGGAGAATGCTGG - Intronic
1083343162 11:61971979-61972001 CAGCACATCCTGGAGCAGGAGGG + Intergenic
1084265815 11:68004594-68004616 CAGCCCAAACTGGAGCAGGATGG - Intronic
1084362441 11:68677679-68677701 TAGCTCAGCCTGGAGGAAGAGGG - Intergenic
1085305816 11:75485599-75485621 CAGCTAATCATGGAGGAGGGAGG + Intronic
1085562208 11:77482467-77482489 CATCTTACTTTGGAGGAGGATGG - Intergenic
1088106209 11:106209493-106209515 CACCTTAACATGGAAGAGGTAGG - Intergenic
1089597576 11:119590845-119590867 CATCTTTTCCTGGAGGTGGAAGG + Intergenic
1089639449 11:119838060-119838082 GTGCTAAGCCTGGAGGAGGATGG + Intergenic
1089775822 11:120835063-120835085 TAGCTTGGCCTGGAGGAAGAAGG + Intronic
1090163191 11:124517239-124517261 CAGCTTTGCCTAGAGGAGAATGG - Intergenic
1090347030 11:126079824-126079846 CAGCCCCACCTGGAGGTGGAAGG + Intergenic
1090383585 11:126343700-126343722 CAGGTGATCCTGGAGTAGGAGGG - Intronic
1091081961 11:132679630-132679652 GGGATTAACCTGGAGGATGATGG + Intronic
1202826154 11_KI270721v1_random:90229-90251 GTGCTTCAGCTGGAGGAGGAAGG - Intergenic
1091406483 12:212806-212828 CAGCCGAAGCTGGAGGTGGAAGG - Intronic
1091447504 12:552453-552475 AAGCTGAACCTGCAGGAGGAAGG - Exonic
1095980550 12:47972087-47972109 AACCTTAACCTGGAGGAAGCAGG + Intergenic
1096370371 12:51064223-51064245 CAGCTGAGCCTGGATGAGAATGG + Exonic
1096828984 12:54300241-54300263 CAGCTGGACCTGGAGGGAGAAGG - Intronic
1097642338 12:62197296-62197318 CTGCTTAGACTTGAGGAGGATGG - Intronic
1097771094 12:63586447-63586469 CAGCATAACCTGGAAGGAGAGGG + Intronic
1097974584 12:65671024-65671046 GAGATTATCCTGGAGGAAGAGGG - Intergenic
1100055248 12:90501230-90501252 CAGCTTTTCCAGGAGGAGGAAGG + Intergenic
1101788906 12:107910930-107910952 GAACCCAACCTGGAGGAGGAAGG + Intergenic
1101932974 12:109030064-109030086 CAGCGTAACTTGCAGGAAGAAGG - Intronic
1102587311 12:113932478-113932500 CAGCTTACCCTGCAGGGAGAAGG - Intronic
1107022870 13:35769118-35769140 CAGCTTAAACTGAAGGATTAGGG + Intronic
1109267168 13:60215239-60215261 CAGCAGAATCTGTAGGAGGATGG - Intergenic
1110847043 13:80201865-80201887 TATCTTAACCTTGGGGAGGAAGG - Intergenic
1114673324 14:24425441-24425463 CAGCCTAACAGGAAGGAGGAAGG - Intergenic
1114852551 14:26398826-26398848 AGGCTGAAGCTGGAGGAGGATGG - Intergenic
1118974821 14:70667564-70667586 CAGCTCAGCCTGGAGCAGGCAGG - Exonic
1120994587 14:90407093-90407115 CAGCATTCCCTGGAGGGGGAGGG - Exonic
1121370497 14:93353987-93354009 TAACTTAAACTGGGGGAGGAGGG + Intronic
1121835545 14:97088867-97088889 GAGGATGACCTGGAGGAGGAAGG + Intergenic
1122418837 14:101563073-101563095 CACCTAAACCTTGAGGGGGAGGG + Exonic
1122636003 14:103129988-103130010 CACATTGGCCTGGAGGAGGAGGG - Exonic
1124148880 15:27159094-27159116 TAGCAGAACATGGAGGAGGAGGG - Intronic
1124177351 15:27438861-27438883 CAGCCTCACCTGGAGGAGCCAGG + Intronic
1124887606 15:33701631-33701653 CAGAGCAACCTGGAGGGGGAGGG + Intronic
1126741943 15:51786202-51786224 CAGCTTACCCTTGAGAAGGGGGG - Intronic
1126853923 15:52818947-52818969 CAGCTTCACCTGAGGAAGGAAGG + Intergenic
1127284522 15:57520837-57520859 CAGCTTAACCAGAAGGAAGTTGG - Intronic
1127692320 15:61409470-61409492 CAGCTTAGCCTGGAAGTGGGAGG + Intergenic
1129107987 15:73322415-73322437 CAGTTAAACCTGAAGGAAGAAGG + Exonic
1129524747 15:76206614-76206636 AAGGTGAGCCTGGAGGAGGAGGG - Intronic
1132309429 15:100846256-100846278 CAGCTTGATGTGGAAGAGGAAGG + Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134135970 16:11676501-11676523 CAGCCTCACCTGGAGGCCGAGGG - Exonic
1134196923 16:12166436-12166458 CAGGTTAACATGGTGAAGGAAGG + Intronic
1135210291 16:20520194-20520216 AAGTTTATCCTGGAGAAGGAAGG + Intergenic
1135934371 16:26767268-26767290 CATTTTAAAGTGGAGGAGGAAGG - Intergenic
1136043556 16:27598974-27598996 CAGCATAACCTGGGGAAGGATGG + Intronic
1136156813 16:28388620-28388642 CAGCGCTACCTGGAGGAGAAGGG - Exonic
1136206273 16:28726661-28726683 CAGCGCTACCTGGAGGAGAAGGG + Exonic
1137701667 16:50502213-50502235 CAGGCTGACCTGGAGGAGAAGGG + Intergenic
1138077711 16:54058646-54058668 CAGTTATACCTGCAGGAGGATGG - Intronic
1139651604 16:68365084-68365106 CACCTGCACCTGGGGGAGGAGGG + Exonic
1141379268 16:83560932-83560954 CAGATTAACCTGGAAGGGAAAGG + Intronic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1143036779 17:4004074-4004096 CTGCGGAACCCGGAGGAGGAAGG - Intergenic
1143462914 17:7115231-7115253 AAGCTTCAGCAGGAGGAGGAAGG + Intronic
1143520414 17:7441185-7441207 CAGCTCAACCAGAAGGGGGAAGG - Intronic
1143973818 17:10815378-10815400 CTGCTCAGTCTGGAGGAGGAAGG - Intergenic
1144677884 17:17173469-17173491 CTGGTTCACCTGCAGGAGGACGG + Intronic
1145265887 17:21379437-21379459 CAGCTGCACCTGTTGGAGGAAGG - Intronic
1145767444 17:27468636-27468658 CAGCTCAGCCTGGAAGCGGATGG - Intronic
1145993748 17:29094082-29094104 CAGCTTGGCCTGGAGGTGGTTGG + Exonic
1148131428 17:45264668-45264690 CAGCTTCGCCTGGAGCTGGAGGG - Exonic
1148615408 17:48997101-48997123 CAGCCCAAACTGGGGGAGGATGG - Intergenic
1150848917 17:68686416-68686438 CAGCTTTACCTGGAGAATCAGGG - Intergenic
1155354820 18:24942054-24942076 CAGACTAACCTAGAAGAGGATGG + Intergenic
1157616105 18:48988708-48988730 CAGCCTGAGCTGGGGGAGGAGGG + Intergenic
1158265754 18:55659287-55659309 CAGATTAAACTTCAGGAGGAAGG - Intronic
1158876049 18:61735547-61735569 CATCTTAACCTCGAGTAGAAGGG - Intergenic
1161025319 19:2034045-2034067 CAGCTGGGCCTAGAGGAGGAAGG - Intronic
1161080146 19:2306519-2306541 CGGCTTACCCTGGGGGTGGACGG + Intronic
1162783335 19:13018657-13018679 CTGCTTATCCTAGAGGAGGGTGG - Intronic
1165127766 19:33612907-33612929 CAGCTCACCCTCAAGGAGGAAGG - Intergenic
1166048215 19:40242174-40242196 CGGCTTAGGCTGGAGCAGGAAGG + Intronic
1167588308 19:50387646-50387668 GTGCTGAAGCTGGAGGAGGAAGG - Intronic
925185169 2:1842267-1842289 CACCTGAACAGGGAGGAGGATGG - Intronic
925880326 2:8346748-8346770 CTGCTTCAGATGGAGGAGGAAGG - Intergenic
927213904 2:20655358-20655380 CATCTTATCCTGAAGAAGGAGGG + Intergenic
927491073 2:23521280-23521302 CAGCTCTGCCTGCAGGAGGAAGG + Intronic
931243770 2:60476135-60476157 GACCTTGACCTGGATGAGGAGGG + Intronic
931293056 2:60893808-60893830 GAGTTTAACATGGAAGAGGAAGG - Intronic
932444531 2:71767977-71767999 CATCTTTTCCTGGAGGAAGACGG - Intergenic
932570048 2:72933826-72933848 CGGCAGAAGCTGGAGGAGGAAGG + Exonic
934640160 2:96023116-96023138 CAGCTGGCCCTGGCGGAGGAAGG + Exonic
934793485 2:97082284-97082306 CAGCTGGCCCTGGCGGAGGAAGG - Intergenic
935170422 2:100607273-100607295 CTGCTTACCCTGGAGGAGTCGGG + Intergenic
935784131 2:106533606-106533628 CAGCTTGGCCTGGAGAAGCAAGG + Intergenic
935946261 2:108289348-108289370 GAGCTGGCCCTGGAGGAGGATGG - Intronic
937575785 2:123419783-123419805 AGGCTAAACCTGGAGGAGCAAGG - Intergenic
937856079 2:126672786-126672808 CCACCTAACCTGGGGGAGGAAGG + Intronic
938070494 2:128305789-128305811 CAGCTGGACCTTGAGGAGGGTGG + Intronic
938289772 2:130142985-130143007 CAGCTCTACTTGGAGGAGGGAGG + Intronic
938466754 2:131529953-131529975 CAGCTCTACTTGGAGGAGGGAGG - Intronic
940285721 2:152031525-152031547 CAGCACAACCTGAGGGAGGAAGG + Intronic
941182780 2:162281367-162281389 CAGCTTCACCTGGTGTTGGAGGG - Exonic
941594673 2:167461030-167461052 CCACTTCAGCTGGAGGAGGAAGG + Intergenic
941735095 2:168965333-168965355 AAGATTAACCTAGAGGAGAATGG - Intronic
942088069 2:172462061-172462083 CAGCTTTACCTTGAGGATGAAGG + Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945491319 2:210458613-210458635 CAGCAGAACCTGGTGGGGGATGG + Intronic
945772208 2:214058198-214058220 ATGATTAAGCTGGAGGAGGAAGG - Intronic
947915359 2:233828876-233828898 CTGCTTCACCTGGAGGGGCATGG - Exonic
948468478 2:238163253-238163275 CAGCCTGCCCTGGAGGAGGCAGG + Intronic
1168888298 20:1275688-1275710 CAGCTAAGCTTTGAGGAGGAAGG - Intronic
1169366717 20:4998513-4998535 CAGCTTAACCTGGAGGAGGATGG + Intronic
1170468451 20:16644321-16644343 AAGCTTCACCTGGAGGGAGATGG - Intergenic
1172029282 20:31970069-31970091 TAGCTTATCCTGGAGGAAAAGGG + Intronic
1172342121 20:34166709-34166731 CAGATTAAGCTGGATGAGGCTGG - Intergenic
1172881486 20:38202704-38202726 CAGCCTGACCTGGGGGTGGAGGG + Intergenic
1173101370 20:40091814-40091836 CAGCTGGAGCTGGAGGAGCAGGG + Intergenic
1173595142 20:44254033-44254055 CAGCTTGGCCTGGAGGATGGAGG + Intronic
1174138771 20:48398496-48398518 CAGCTGTACCTGGAGGGGGCTGG + Intergenic
1174429337 20:50456468-50456490 CTGCTCACCCTGGAGGGGGAAGG + Intergenic
1174489534 20:50882961-50882983 CAGCTTAATGTGGTGGAGGATGG + Intergenic
1176143933 20:63557173-63557195 CAGCTGATCCTGGAGGAGAGAGG - Intergenic
1178933762 21:36842865-36842887 CAGCCTAACCAGCAGGATGAGGG + Intronic
1179410230 21:41156778-41156800 GAGCTTAACAGGGAGGGGGAAGG - Intergenic
1179542200 21:42090417-42090439 AAGCTGAACCTGGAGTGGGAAGG + Exonic
1180117859 21:45723965-45723987 CAGCTTATGCTGGAGGAGGACGG - Intronic
1180180646 21:46117386-46117408 CAGCTTGCCCTGAAGGAGAAGGG - Exonic
1182041024 22:27239234-27239256 CAGCTGCAGCTGGAGGAGGAAGG + Intergenic
1182796671 22:32995992-32996014 CAGCTGCACCAGAAGGAGGAGGG + Intronic
1183382710 22:37498416-37498438 CACCTTGGCCTGGAGGAGGTGGG + Intronic
1183743551 22:39680916-39680938 CAGCTGCACCTGCAGGAAGAGGG - Exonic
949702610 3:6776441-6776463 CAGCTAAACCTGGGGCAGAATGG - Intronic
953389824 3:42527638-42527660 CAGCTTCCCCTGGAGAAGGCAGG + Intronic
953998832 3:47540634-47540656 TGGCTTAACCTGCAGGAGGGAGG - Intergenic
954443113 3:50532570-50532592 CAGCTGAGCCAGGAGGAGAAAGG + Intergenic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
959259205 3:104053214-104053236 CCACTGAACCTGCAGGAGGATGG - Intergenic
959664135 3:108902688-108902710 CAGCTGGTCCAGGAGGAGGACGG - Intergenic
960225905 3:115168292-115168314 CTGCTTAGCCTGGATGAGGATGG - Intergenic
961131979 3:124477299-124477321 CAGCTTATCCTGGAGCATGCGGG + Exonic
962293666 3:134160124-134160146 CAACTGAACTTGGATGAGGAGGG + Intronic
963307745 3:143672658-143672680 AAGCTTAGCCTTGAGGAAGATGG - Intronic
966278497 3:178203976-178203998 GAGCTTAGCCTGGAGTAGGAAGG - Intergenic
969203292 4:5622696-5622718 CAGCAGATCCTGGAGGAGCACGG - Exonic
969347879 4:6580581-6580603 CAGCTGCATCTTGAGGAGGAGGG - Intronic
969598344 4:8161453-8161475 GAGCTGAGGCTGGAGGAGGAGGG - Intergenic
970444560 4:16112834-16112856 CAGTTGAACCCAGAGGAGGAGGG - Intergenic
970723372 4:19014183-19014205 CAAGTTTACCTGGGGGAGGAAGG + Intergenic
971553611 4:27983531-27983553 CTGCTTTCACTGGAGGAGGATGG - Intergenic
973893148 4:55387856-55387878 TCGCCTAACCTGGGGGAGGATGG + Intergenic
975577711 4:75879117-75879139 CACCTTAACCTAGTGGAGGGAGG + Intronic
978084929 4:104639700-104639722 CAGCTTAGCCTTGAGGAGTCTGG - Intergenic
980876285 4:138665628-138665650 CAGCTTTAGCTGGAGTAGGGTGG - Intergenic
983100725 4:163622708-163622730 CAGCTAAACGTGGAAGAGGGTGG + Intronic
985026414 4:185743709-185743731 CATCTGAATCAGGAGGAGGAGGG - Intronic
986040006 5:3984233-3984255 GAGCTTAAGCTTGAGGAAGAAGG - Intergenic
986148547 5:5104720-5104742 CAGCTTAGCCAGGAGGCAGAGGG - Intergenic
986274118 5:6258565-6258587 CTGCTAAACCTGGAGGACTAGGG + Intergenic
986298434 5:6458971-6458993 CCACCCAACCTGGAGGAGGAAGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987103483 5:14613774-14613796 CAGACTAAGCTGGTGGAGGATGG + Intronic
988238108 5:28573334-28573356 CAGTTCAAAGTGGAGGAGGATGG - Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988796485 5:34656942-34656964 CGGCTGAACTTGGAGGAGGTGGG + Intronic
991319180 5:65350232-65350254 CAACTTAACCTGCAGCATGAAGG - Intronic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
994200056 5:96963424-96963446 CAGCTTGACTTGGAGCCGGATGG + Intronic
994302597 5:98163622-98163644 CAGCTTTCCCGGGAGAAGGATGG + Intergenic
995932679 5:117468238-117468260 TTGTTTAGCCTGGAGGAGGATGG - Intergenic
996481200 5:123976631-123976653 CAGGTTAGCCTGCAGGAAGAAGG - Intergenic
998520826 5:142798908-142798930 CAGCTTGGCCTGGTGGATGAAGG - Intronic
999876115 5:155807865-155807887 CAGCTTACCTTGGGGTAGGATGG + Intergenic
1001699076 5:173693813-173693835 CACCAGAAGCTGGAGGAGGAAGG + Intergenic
1002687787 5:181027999-181028021 CAGCTCAACTTGGAGTGGGAAGG + Intergenic
1005434382 6:25792663-25792685 AAGCTTGACAAGGAGGAGGATGG - Intronic
1005484281 6:26284831-26284853 AAGCTTAAACTGAAGGAGGAAGG + Intergenic
1005872472 6:29985229-29985251 CAGCGTACCCTGGATGTGGATGG - Intergenic
1009404896 6:63300139-63300161 CAGGCAAAGCTGGAGGAGGAAGG - Intronic
1009902534 6:69825839-69825861 CAGCTTTACCTCAAGGAGGATGG + Intergenic
1010111946 6:72247188-72247210 CAACTTCACATGGAGGAGGCTGG - Intronic
1016120507 6:140337437-140337459 CAGGTGATTCTGGAGGAGGAAGG - Intergenic
1019961189 7:4461328-4461350 CAGCTTTCTCTGGAGGAGGAGGG - Intergenic
1022930577 7:35108713-35108735 CAGCATAACCTGGAAGGAGAGGG + Intergenic
1023066647 7:36384542-36384564 CAGCTTACACTGTAGTAGGAAGG + Intronic
1024618459 7:51136187-51136209 GCCCTGAACCTGGAGGAGGAGGG + Exonic
1024895651 7:54259044-54259066 TACCTTAACCAGGAGGAGAAAGG - Intergenic
1025014514 7:55428073-55428095 CAGCTGAAGCGGCAGGAGGAAGG + Intronic
1026398309 7:69982441-69982463 CAGGATAGCCTGGAGCAGGAGGG - Intronic
1026598664 7:71754902-71754924 GAACTTATCCTGGAGAAGGAAGG - Intergenic
1027811599 7:82908436-82908458 ACGCTTAACCTGGAGGAGAAAGG - Intronic
1029826477 7:103201224-103201246 CAGCATAACCTGGAAGGAGAGGG + Intergenic
1029846277 7:103415312-103415334 GAGCAAAACCTGGAGGAAGAGGG - Intronic
1032982583 7:137300946-137300968 CAGCTTAAGGTAGAGGTGGAAGG - Intronic
1033604787 7:142919049-142919071 CAGGTCAACATGGTGGAGGAAGG - Intronic
1035093811 7:156335654-156335676 CAGCTTGAGCTGGAGCAGGAAGG + Intergenic
1037748854 8:21667017-21667039 GAGCTCACGCTGGAGGAGGAAGG + Intergenic
1037809965 8:22081308-22081330 CAGCTCAGCATGGAGGGGGAGGG - Intronic
1042962432 8:74318639-74318661 GACATTAAACTGGAGGAGGAAGG - Intronic
1045560499 8:103257429-103257451 CAGGTAAGCATGGAGGAGGAGGG - Intergenic
1047513809 8:125536291-125536313 GAGCTTAAGCTGAAGGAGCAGGG + Intergenic
1048141999 8:131803769-131803791 TAGCTGAATATGGAGGAGGAGGG + Intergenic
1048856696 8:138692774-138692796 CAGCTCAGCCTGGAGGGGAATGG - Intronic
1049193274 8:141300877-141300899 AAGCTTAACATGGAGCAGCACGG + Intronic
1049776041 8:144405667-144405689 CAGATTCACCTGGAGAGGGAGGG - Intronic
1052986222 9:34490149-34490171 CAGCTTGAGCTGGAAGAAGAGGG - Intronic
1053290696 9:36878038-36878060 CCACAAAACCTGGAGGAGGAAGG + Intronic
1055751021 9:79504933-79504955 CAGCTTATCTTGGAGGATTAGGG - Intergenic
1057338224 9:94174436-94174458 CTGCTTTACCTGGAGGTTGAGGG + Intergenic
1058183386 9:101824844-101824866 CAGCTAAACATGCAGAAGGAGGG + Intergenic
1059760034 9:117329054-117329076 CAGGTTAACCTGCAGCTGGAGGG + Intronic
1061201109 9:129139022-129139044 CAGGATAAGCTGGAGGAGCAGGG + Intronic
1061665158 9:132156378-132156400 CAGCTTTGCCTGGAGGAGCCTGG + Intergenic
1061731661 9:132619428-132619450 CTGCTTAACCTTGTAGAGGACGG + Intronic
1062047263 9:134430258-134430280 CAGCTTCAGCTGGAGCGGGAAGG + Intronic
1062421883 9:136486597-136486619 GAGCTCTTCCTGGAGGAGGAGGG + Intergenic
1203786446 EBV:130673-130695 CAGCTTAACCTCGCTGAGGCTGG + Intergenic
1185918456 X:4062733-4062755 GAGATCATCCTGGAGGAGGAAGG + Intergenic
1187233963 X:17449173-17449195 CAGCTTTATCTGGAGCAAGATGG - Intronic
1187808091 X:23143302-23143324 AAGCTAAACCCAGAGGAGGAGGG - Intergenic
1189628073 X:42920907-42920929 CACTTTAACCTGGAGCAGCAAGG - Intergenic
1190296483 X:49030477-49030499 CAGCTGGACATTGAGGAGGAGGG - Exonic
1190485879 X:50924510-50924532 CAGATGAACCTGGAGGATGGAGG - Intergenic
1196434199 X:115660060-115660082 CAGCTTGATGTGGAGGAGGAAGG - Intergenic
1196730779 X:118939094-118939116 GCCCTGAACCTGGAGGAGGAGGG - Intergenic
1196758669 X:119180087-119180109 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1196758948 X:119182359-119182381 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1198184371 X:134238776-134238798 CAGTTCAAACTGGAGAAGGAGGG + Exonic