ID: 1169367610

View in Genome Browser
Species Human (GRCh38)
Location 20:5003604-5003626
Sequence GGATAGACTTAAAAGCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169367610_1169367619 6 Left 1169367610 20:5003604-5003626 CCCCTGAGCTTTTAAGTCTATCC 0: 1
1: 0
2: 0
3: 9
4: 171
Right 1169367619 20:5003633-5003655 CATCGTTATTCCATGAACTGTGG 0: 1
1: 0
2: 0
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169367610 Original CRISPR GGATAGACTTAAAAGCTCAG GGG (reversed) Intronic
902445736 1:16462807-16462829 GGATAGACTTAATAGCTGTAGGG + Intergenic
904582047 1:31551323-31551345 GGATACACTAAAAATGTCAGAGG - Intergenic
905828344 1:41044476-41044498 GGATACACTAAGAAGCACAGAGG + Intronic
907611744 1:55878097-55878119 GGAAAGAGTTACAACCTCAGAGG + Intergenic
908154308 1:61336688-61336710 GGAGAGAGTAAAAAGATCAGTGG - Intronic
911276534 1:95866783-95866805 GAACAGCCTTAAAAACTCAGTGG + Intergenic
911285971 1:95992763-95992785 GGCTACACATAAAATCTCAGTGG + Intergenic
913028041 1:114865864-114865886 GGAGACAGTTAAAAGATCAGTGG - Intronic
913343832 1:117787833-117787855 GCATAGTCCCAAAAGCTCAGAGG - Intergenic
913665069 1:121040676-121040698 GGAGAGAGTAAAAAGATCAGTGG + Intergenic
915090834 1:153424276-153424298 AGATAAACATCAAAGCTCAGAGG + Intergenic
917952713 1:180056967-180056989 GGATAGACTTAGCAGCACACTGG - Intronic
918417327 1:184324764-184324786 TGATAGTCTTAAAATCTCTGTGG + Intergenic
920057086 1:203200724-203200746 GGATAAACTAAAGAGCTCACAGG + Intergenic
920507718 1:206528367-206528389 GGAAACAGTTAAAAGATCAGGGG + Intronic
921045298 1:211472611-211472633 AGATAAACTTCAAATCTCAGTGG + Intergenic
923856615 1:237851806-237851828 AGATAGACTTAAAAAATTAGAGG - Intergenic
1063304064 10:4880171-4880193 GGATACAGTAAAAAGATCAGTGG - Intergenic
1063792794 10:9473661-9473683 GGAGAGAGTAAAAAGATCAGTGG + Intergenic
1066608483 10:37208910-37208932 AGATAGAGTAAAAAGATCAGTGG - Intronic
1067529060 10:47057455-47057477 GGAGACAATTAAAAGATCAGTGG + Intergenic
1069733544 10:70635350-70635372 GGATAAACATAAAAGGTCAATGG - Intergenic
1070744618 10:78925898-78925920 GGAGAGACTTGAAACCACAGTGG - Intergenic
1071047018 10:81392470-81392492 GGCTAAAGTTAAAAGATCAGTGG - Intergenic
1071546008 10:86530227-86530249 GGAGAGAGTAAAAAGATCAGTGG + Intergenic
1071742799 10:88379940-88379962 GGAAAGACTCAAAAGCTGGGAGG - Intronic
1072073804 10:91948298-91948320 GGATAGACTTAACAGCTTAATGG - Intronic
1072279118 10:93850111-93850133 GGAGAGCATTAAAAGTTCAGAGG + Intergenic
1072498943 10:95992565-95992587 GGAGAAAGTTAAAACCTCAGAGG + Exonic
1076255150 10:129017342-129017364 GGAGAGACTTATGTGCTCAGTGG - Intergenic
1076277582 10:129216769-129216791 GGAGAGACTAAAAATCTTAGTGG + Intergenic
1076644455 10:131943002-131943024 GGAGAGCCTTGAAAGCTTAGGGG - Intronic
1079664805 11:23091988-23092010 GTATTGACTTCAAAGCTAAGGGG - Intergenic
1079937409 11:26634905-26634927 GGGTAGACATAAACGCTCACTGG - Intronic
1081553259 11:44133571-44133593 GGAAAGATTTAAATACTCAGAGG - Intronic
1083868966 11:65475291-65475313 GGAGAGACTGAAATACTCAGAGG + Intergenic
1086535900 11:87845464-87845486 GGATAGACTCAAAAGCAAAATGG + Intergenic
1088390686 11:109311323-109311345 GGAAAGAGTTAAAAGATGAGAGG - Intergenic
1090290018 11:125535106-125535128 GGATAAAATTAAAAGTTCTGTGG - Intergenic
1093012041 12:14117629-14117651 GGATAGACTCAAAAGCAAAATGG + Intergenic
1093257837 12:16893126-16893148 GGATAGTATTAAAAGGTTAGGGG + Intergenic
1097539582 12:60922684-60922706 TGATAAACTTCAAAGCTTAGAGG + Intergenic
1097781726 12:63714393-63714415 GAACAGACTTAGAGGCTCAGTGG - Intergenic
1099770814 12:87052987-87053009 GGAAACAATTAAAAGATCAGTGG + Intergenic
1100082790 12:90873751-90873773 GGAGAGAGTAAAAAGATCAGCGG + Intergenic
1100213473 12:92422778-92422800 TTATATATTTAAAAGCTCAGTGG - Intronic
1101805061 12:108056408-108056430 GGATGGACATAGTAGCTCAGAGG - Intergenic
1102609532 12:114099350-114099372 GGATGGTCTTAACAGCTCAATGG + Intergenic
1106332330 13:28750672-28750694 GGATAAACTCAAGAGCACAGGGG + Intergenic
1108786777 13:53912581-53912603 TGAAAGATTTAAAAGCACAGAGG - Intergenic
1113873034 13:113574390-113574412 GGAGACAGTTAAAAGATCAGTGG + Intergenic
1116801772 14:49451282-49451304 GGATCCACTTAAACTCTCAGAGG + Intergenic
1117694664 14:58347856-58347878 AGATAGAATTAAAATCTCCGAGG + Exonic
1119349650 14:73953610-73953632 GGATACACTAGAAAGCTAAGTGG - Intronic
1125284703 15:38079963-38079985 GGATAGAGATAATAGCTAAGTGG - Intergenic
1126127389 15:45308252-45308274 GGATAGAATCAAGAGTTCAGGGG + Intergenic
1127681180 15:61300237-61300259 GGATACAGTGAAAAGATCAGTGG + Intergenic
1128226375 15:66004210-66004232 GGGAGGACTTAAGAGCTCAGGGG - Intronic
1128624802 15:69189219-69189241 GGAGAGAGTGAAAAGATCAGTGG - Intronic
1130765617 15:86867810-86867832 GGATTGACTTTAAAGATCTGAGG + Intronic
1131042062 15:89278627-89278649 TGATATACTTAAAAGCTGAAGGG + Intronic
1134741677 16:16552856-16552878 GAGAAGACTTAAAAGCTCACAGG - Intergenic
1134925887 16:18159582-18159604 GAGAAGACTTAAAAGCTCACAGG + Intergenic
1138032857 16:53574471-53574493 GGAGACAGTTAAAAGATCAGGGG - Intergenic
1141379667 16:83565043-83565065 GGAGAGACTCAAAAGCGCTGAGG - Intronic
1147658960 17:42106928-42106950 GGTCAGAGTTAAAAGCTCAAGGG - Intronic
1148817157 17:50337226-50337248 AGATAGACTGGAAAGCTTAGAGG - Intergenic
1151495823 17:74457538-74457560 GGATTGCCTTAAAAGGTGAGAGG - Intergenic
1153361438 18:4202012-4202034 CAATAAACATAAAAGCTCAGGGG - Intronic
1154379950 18:13840020-13840042 GGATAGTCTTTAAAATTCAGAGG + Intergenic
1159587689 18:70296806-70296828 TTATAGACTGAAAAGCTCTGTGG - Intronic
1160360717 18:78274614-78274636 GGAGATAGTTAAAAGGTCAGTGG - Intergenic
1163107382 19:15132894-15132916 GGAGAAACTTAAAGGCTCAAAGG - Intergenic
1165164507 19:33842082-33842104 ACATAAACTGAAAAGCTCAGAGG - Intergenic
1165564110 19:36708657-36708679 GGAGAGAGTAAAAAGATCAGTGG - Intronic
1168274483 19:55269685-55269707 GGAGACAGTAAAAAGCTCAGGGG + Intronic
925316015 2:2923999-2924021 GGAGATAGTGAAAAGCTCAGGGG - Intergenic
925926410 2:8674105-8674127 GAATGGACTCAAAAGCACAGTGG + Intergenic
926232590 2:11016118-11016140 GGAGAGGCATAAAGGCTCAGTGG - Intergenic
926519776 2:13896703-13896725 GAATAGTTTGAAAAGCTCAGAGG + Intergenic
932072071 2:68630538-68630560 GGGTTGACTTACAGGCTCAGTGG - Intronic
934100661 2:88650167-88650189 GGAGACACTAAAAAGATCAGTGG - Intergenic
939011161 2:136847393-136847415 GGATAGGATTACAGGCTCAGAGG + Intronic
939931581 2:148240782-148240804 GGATAGGCTTAACAGCACATTGG - Intronic
940963823 2:159815329-159815351 GCACATAATTAAAAGCTCAGTGG - Intronic
941033906 2:160545378-160545400 GGAAAGAATAAAAAGATCAGTGG - Intergenic
941837030 2:170034364-170034386 GGAGAGAGTAAAAAGATCAGTGG - Intronic
942354055 2:175088243-175088265 GAATATAGTTAAAAACTCAGTGG + Intronic
943952042 2:194142742-194142764 GGAGAGAGTAAAAAGATCAGTGG - Intergenic
945434610 2:209804352-209804374 GGATAGAATTAATAGCCCAGAGG - Intronic
946992304 2:225348314-225348336 AGATTGGCTTAAAAGCTCATTGG - Intergenic
947083519 2:226425208-226425230 GGACAGATTTAAAAGATTAGAGG - Intergenic
947340386 2:229132160-229132182 GGATACACTTATTATCTCAGGGG + Intronic
947813804 2:233022723-233022745 GGAGAGTCTGGAAAGCTCAGGGG - Intergenic
1169367610 20:5003604-5003626 GGATAGACTTAAAAGCTCAGGGG - Intronic
1173026725 20:39314296-39314318 GGATAAACTGAAAATCTCTGGGG - Intergenic
1175572020 20:60030642-60030664 GGATGGACTTTGAAGCTGAGAGG + Intronic
1177365161 21:20125603-20125625 TGATATACTTAAACGGTCAGTGG - Intergenic
1177902965 21:26939060-26939082 GTAAAGACCTAAAAGCTGAGGGG - Intronic
1177919516 21:27133503-27133525 GGTTAGATTTAAAAGATTAGTGG + Intergenic
1181879977 22:25970811-25970833 AGAGAGACTTAAACACTCAGGGG + Intronic
1183949980 22:41347452-41347474 GGAGGGAATTAACAGCTCAGTGG - Intronic
951659439 3:25046220-25046242 GGGTAGACTGATAAGCTCAAAGG + Intergenic
955010162 3:55006168-55006190 CATTAGATTTAAAAGCTCAGTGG + Intronic
956814779 3:72898258-72898280 TGAAAGACTTTAAAGCTTAGAGG - Intronic
958595822 3:96221100-96221122 GAATAGACTTAAACACTCAGGGG - Intergenic
967012405 3:185448464-185448486 GAAAAGACTTATAACCTCAGAGG - Intronic
967622311 3:191649014-191649036 GGAAAGACTTGACAGCTAAGGGG + Intergenic
968844492 4:3032522-3032544 GGATAGAAACAAAGGCTCAGGGG + Intronic
969884969 4:10207326-10207348 GGAGAAACTTATAAGCCCAGGGG - Intergenic
971189247 4:24411701-24411723 GGAGACACTAAAAAGATCAGAGG - Intergenic
972814063 4:42623843-42623865 GGAGAGACTTTTAAGTTCAGGGG - Intronic
972886568 4:43498562-43498584 GGATAAAGTAAAAAGATCAGTGG - Intergenic
973709699 4:53616297-53616319 CCATACACTTAAAAGCTCATAGG + Intronic
977611641 4:99040207-99040229 GGACAGAGTTTAAGGCTCAGAGG + Intronic
979721137 4:123901939-123901961 GGATGGCCTTAGAAACTCAGAGG + Intergenic
980905474 4:138944478-138944500 GGATTGATTTAAAAACTCACAGG - Intergenic
981418627 4:144522925-144522947 GGATAAAATTATGAGCTCAGTGG + Intergenic
981716171 4:147754505-147754527 AGATAGAAAGAAAAGCTCAGTGG + Intronic
982042171 4:151408019-151408041 TGATGGACTTTAAATCTCAGAGG - Intergenic
985281220 4:188287619-188287641 GGATAAACCTTAAAGCTCATGGG - Intergenic
987821082 5:22967617-22967639 TGATCCACTTAAAAGCACAGTGG - Intergenic
989516133 5:42346321-42346343 GAAGACAATTAAAAGCTCAGTGG + Intergenic
990714712 5:58623960-58623982 GCAAATACTTAACAGCTCAGGGG - Intronic
992544813 5:77802777-77802799 GGAGACACTAAAAAGATCAGTGG + Intronic
996990947 5:129630406-129630428 GGAGAGACTTAACTCCTCAGTGG + Intronic
998515085 5:142745802-142745824 GAATAGCCCTAAAATCTCAGTGG + Intergenic
998901731 5:146862658-146862680 GGAGAGACTTAAAAGATGAGAGG + Intronic
1002799544 6:508475-508497 GGAGAGATTAAAAAGATCAGTGG - Intronic
1003097796 6:3156362-3156384 GGATAGACTGAAAGGCTGGGAGG + Intronic
1005442851 6:25889853-25889875 AGATAAACTGAAAATCTCAGTGG + Intergenic
1005993184 6:30915932-30915954 GGATAAACATTTAAGCTCAGGGG + Intronic
1006685221 6:35827253-35827275 GGATCCACTTCCAAGCTCAGTGG + Intronic
1009358692 6:62787402-62787424 GGAGACAGTTAAAAGATCAGTGG - Intergenic
1011274688 6:85618838-85618860 GGAAAGAAAGAAAAGCTCAGAGG - Exonic
1011656705 6:89558529-89558551 GGAGAGAGTAAAAAGATCAGTGG + Intronic
1011706763 6:90008423-90008445 TGATACACTTAAAGTCTCAGAGG - Intronic
1012891424 6:104901831-104901853 GGAGACACTAAAAAGATCAGTGG - Intergenic
1012959106 6:105603891-105603913 GGAGAGACTTCAAAGGTCAACGG + Intergenic
1013586190 6:111581189-111581211 GAATAGAACTAAAAGCCCAGAGG + Intronic
1014228572 6:118876187-118876209 GGAGATATTTAAAAGATCAGTGG + Intronic
1014596294 6:123344460-123344482 GGAGAAAGTTAAAAACTCAGTGG - Intronic
1015789204 6:136949722-136949744 GGAGACACTAAAAAGATCAGTGG + Intergenic
1016115633 6:140281820-140281842 GGAGACATTTAAAAGTTCAGTGG + Intergenic
1018359887 6:163056712-163056734 AGATAAACTGAAAATCTCAGAGG + Intronic
1021922764 7:25503212-25503234 GAATGGATTTAAAAGCACAGGGG + Intergenic
1022940323 7:35230485-35230507 GAACAGACTTAGAGGCTCAGTGG - Intronic
1023036191 7:36133596-36133618 GGAGAGAGTAAAAAGATCAGGGG + Intergenic
1027358928 7:77388239-77388261 GTTTAGACTTAAAAGCCTAGAGG - Intronic
1030623755 7:111820732-111820754 GGATTGAATTAAAATTTCAGTGG - Intronic
1032931946 7:136682482-136682504 GGAGAGAGTAAAAAGTTCAGTGG + Intergenic
1033907158 7:146219095-146219117 GGAAAGACAGAAAAGTTCAGGGG + Intronic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1037012632 8:13862944-13862966 TGATAGACTCCAAATCTCAGGGG - Intergenic
1038993664 8:32897462-32897484 GGTTAAACTTAAAAGCTTAAGGG - Intergenic
1039421376 8:37444892-37444914 AGATAGACTTAAAAGCACATTGG + Intergenic
1040086883 8:43352450-43352472 GGATACAGTAAAAAGATCAGTGG - Intergenic
1040406188 8:47105505-47105527 GGATACAGTAAAAAGATCAGTGG + Intergenic
1040729747 8:50429284-50429306 CGATAGACATAATAGATCAGTGG + Intronic
1041250268 8:55927274-55927296 GGAGACACTAAAAAGATCAGTGG - Intronic
1041951070 8:63503015-63503037 GGAGACACTTAAAAAATCAGTGG - Intergenic
1043035481 8:75192537-75192559 GGAAACACTAAAAGGCTCAGTGG + Intergenic
1043844548 8:85149470-85149492 GGAAAGAATTCAAAGCTCAAAGG + Intergenic
1049581748 8:143414970-143414992 AGATAAACTGAAAATCTCAGAGG + Intergenic
1051080285 9:13286190-13286212 GGAGAGATTTAAAAGCTGTGGGG - Intergenic
1053271571 9:36753226-36753248 GGAGAGAGTAAAAAGCTCAGTGG + Intergenic
1053430549 9:38039357-38039379 GGCAAGACTTTAAAGCGCAGTGG + Intronic
1053897630 9:42759486-42759508 GGTGAGTCTTCAAAGCTCAGCGG + Intergenic
1056809277 9:89751758-89751780 GGATACATTTAAAAACTCAGTGG - Intergenic
1057797264 9:98167565-98167587 GAAGAGACTTAAGAGATCAGAGG + Intronic
1058567414 9:106301178-106301200 TGATAGGATTAAAAGCTGAGGGG - Intergenic
1059009834 9:110444977-110444999 GGATAGAAAAAAAAGCTCAGTGG + Intronic
1059154476 9:111977571-111977593 TGGTGGACTTGAAAGCTCAGGGG + Intergenic
1186052353 X:5611653-5611675 AGATAGACTAAAAAATTCAGGGG - Intergenic
1186712365 X:12212654-12212676 GGACAGATTTCAAACCTCAGGGG + Intronic
1190997666 X:55626380-55626402 GAATAGAGTTCAAAGCTCAGAGG - Intergenic
1191702333 X:64055982-64056004 AGATAGAGTAAAAAGATCAGTGG - Intergenic
1193629591 X:83866390-83866412 GGATAGAGCTGAAAGCCCAGGGG - Intronic
1195122062 X:101764779-101764801 TGATACACTGAAAGGCTCAGGGG + Intergenic
1196609272 X:117692604-117692626 GGAGACAGTAAAAAGCTCAGTGG - Intergenic
1197475009 X:126911432-126911454 GGAGATAGTTAAAAGATCAGAGG + Intergenic