ID: 1169379606

View in Genome Browser
Species Human (GRCh38)
Location 20:5095317-5095339
Sequence AAACCTATCCTGCCTCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 153}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169379604_1169379606 -5 Left 1169379604 20:5095299-5095321 CCCACAGAAATCGAAAGAAAACC 0: 1
1: 0
2: 2
3: 28
4: 373
Right 1169379606 20:5095317-5095339 AAACCTATCCTGCCTCTCACTGG 0: 1
1: 0
2: 1
3: 14
4: 153
1169379602_1169379606 2 Left 1169379602 20:5095292-5095314 CCTGCCTCCCACAGAAATCGAAA 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1169379606 20:5095317-5095339 AAACCTATCCTGCCTCTCACTGG 0: 1
1: 0
2: 1
3: 14
4: 153
1169379601_1169379606 7 Left 1169379601 20:5095287-5095309 CCAGGCCTGCCTCCCACAGAAAT 0: 1
1: 0
2: 1
3: 32
4: 388
Right 1169379606 20:5095317-5095339 AAACCTATCCTGCCTCTCACTGG 0: 1
1: 0
2: 1
3: 14
4: 153
1169379603_1169379606 -2 Left 1169379603 20:5095296-5095318 CCTCCCACAGAAATCGAAAGAAA 0: 1
1: 0
2: 0
3: 24
4: 308
Right 1169379606 20:5095317-5095339 AAACCTATCCTGCCTCTCACTGG 0: 1
1: 0
2: 1
3: 14
4: 153
1169379605_1169379606 -6 Left 1169379605 20:5095300-5095322 CCACAGAAATCGAAAGAAAACCT 0: 1
1: 0
2: 2
3: 32
4: 282
Right 1169379606 20:5095317-5095339 AAACCTATCCTGCCTCTCACTGG 0: 1
1: 0
2: 1
3: 14
4: 153
1169379600_1169379606 16 Left 1169379600 20:5095278-5095300 CCTGAGGCACCAGGCCTGCCTCC 0: 1
1: 0
2: 4
3: 64
4: 563
Right 1169379606 20:5095317-5095339 AAACCTATCCTGCCTCTCACTGG 0: 1
1: 0
2: 1
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169379606 Original CRISPR AAACCTATCCTGCCTCTCAC TGG Intronic
902287606 1:15416656-15416678 AATCCTATTCTGCCCCTCACTGG - Intronic
903009688 1:20320802-20320824 AAACCTTATCTGCCTCTCAGAGG - Intronic
903694363 1:25196266-25196288 AAACCCAGCCTGCCCCTCCCAGG + Intergenic
906431437 1:45758856-45758878 AAACCTATCCTGGCTTCCAAGGG + Intergenic
907144859 1:52222638-52222660 AAACCTATCCTGGCTTCCAAGGG + Intronic
907311554 1:53541775-53541797 AACTCCGTCCTGCCTCTCACAGG - Intronic
908515924 1:64892770-64892792 AGACCTATCTCACCTCTCACTGG - Intronic
908767077 1:67564011-67564033 AAGCCTATCGTGTCTATCACTGG + Intergenic
909806137 1:79875840-79875862 ATAACTATCCTGCCTCTGCCTGG + Intergenic
916425928 1:164679748-164679770 AAACCTATAGTGCTACTCACAGG - Intronic
920177895 1:204114546-204114568 AAACCTCTCCTTCCAGTCACTGG - Exonic
1068706554 10:60082830-60082852 TTACCTTTCCTGCCTCTCATAGG - Intronic
1071783598 10:88875070-88875092 GGACCTTTCCTGCCTCTGACTGG - Intergenic
1071815899 10:89232566-89232588 AAACCATTCCTGCCTTTCTCTGG - Intronic
1075119917 10:119657278-119657300 AAGCATGTCCTGCCTCTCCCTGG + Intronic
1075955604 10:126520435-126520457 AAACCCAGCCTGCTTCCCACAGG + Intronic
1076546500 10:131248964-131248986 CATCCCATCCTGCCTCTCCCCGG - Intronic
1077291979 11:1801186-1801208 AAAACTATGCTGCCTGTCTCAGG + Intergenic
1078968679 11:16379124-16379146 AAATCTATACTACCTCTCAAAGG + Intronic
1080426074 11:32155395-32155417 AGCCCTCTCCTGCCTCTTACAGG + Intergenic
1086273831 11:85100212-85100234 AAATCTATGTTGCCTCTCAAAGG - Intronic
1086484274 11:87281643-87281665 AAACCTTTGCTGCCCCTCCCTGG + Intronic
1087509191 11:99068546-99068568 TAACCCAGCCTGCTTCTCACGGG - Intronic
1090996271 11:131868563-131868585 ACACCTTTCCAGCCTCACACTGG + Intronic
1092764590 12:11841307-11841329 AACGCAATCCTGCCTCTAACTGG - Intronic
1093318008 12:17675564-17675586 AAACCTATCCTGCCTTTTGCAGG - Intergenic
1096913905 12:55011801-55011823 AAACATATCCTCCCACTCATGGG - Intergenic
1097195975 12:57242687-57242709 CACCCCAGCCTGCCTCTCACTGG + Intergenic
1097306738 12:58077433-58077455 AAACCCTTCCTTCCTCTCTCTGG - Intergenic
1098384889 12:69908237-69908259 AAACATGTCCTCACTCTCACGGG + Intronic
1098482162 12:70976393-70976415 ACACGGATCCTGCCTCTCAGTGG - Intergenic
1103964925 12:124632612-124632634 AAGCGTATCCTCCCTCTCCCCGG - Intergenic
1104221273 12:126787092-126787114 AAACATATCATGACTATCACAGG - Intergenic
1106595550 13:31132405-31132427 ATACCTCTCCCGCTTCTCACAGG - Intergenic
1107360634 13:39614184-39614206 ACACCTGGCCTTCCTCTCACAGG - Intergenic
1108592924 13:51926568-51926590 TAACCTGTTTTGCCTCTCACGGG - Intergenic
1108705332 13:52980339-52980361 AAACCTAGCCTGCCCCCCATAGG - Intergenic
1108819417 13:54329071-54329093 AAACATCTCCTGCTTCTAACGGG + Intergenic
1110362001 13:74636966-74636988 AAACATATTCTCCTTCTCACAGG + Intergenic
1112681053 13:101765361-101765383 AAACCCATCCAGCCTCTAAATGG + Intronic
1114011657 14:18375696-18375718 AAACATAGCCTGTCTCACACAGG + Intergenic
1117646109 14:57854689-57854711 AGACCCATTCTGCCACTCACTGG + Intronic
1121719482 14:96099170-96099192 AAGCCTACCCTGTCACTCACTGG - Intergenic
1122309044 14:100783190-100783212 TCCCCGATCCTGCCTCTCACGGG - Intergenic
1123143795 14:106108604-106108626 AGACCTATTCTGCCCCTCCCAGG - Intergenic
1124147766 15:27144330-27144352 AAACCCATGCTGCCTCTTCCAGG - Intronic
1124454879 15:29832924-29832946 AAAGCTAGGCGGCCTCTCACAGG - Intronic
1126063062 15:44802582-44802604 AAATCTTTCCTGCATCTCAGTGG - Intergenic
1132859139 16:2061470-2061492 AAGCCTTTCTTGCCTCTCCCAGG - Intronic
1133229580 16:4360167-4360189 AAACCATTCCTGCCCCTCACTGG - Intronic
1134483134 16:14635540-14635562 AAGGCTATCCTGGCTCTCGCTGG - Intronic
1134791985 16:16997406-16997428 AAATAAATCCTGCCTCGCACAGG + Intergenic
1135047040 16:19164498-19164520 AAGCCTCTCCTGCCTTTCACGGG - Intronic
1135541469 16:23333252-23333274 AAACCTAGCCTGCCTGGCCCTGG - Intronic
1136588584 16:31203028-31203050 AAACCTGGGCTGGCTCTCACTGG + Exonic
1140120435 16:72078890-72078912 AAACCTATTCTGCCTTTCAAGGG - Intronic
1142489347 17:267997-268019 AAACCCACCCTCCCTCTCAGAGG + Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1144859367 17:18290802-18290824 ACAACTGTCCTCCCTCTCACTGG + Intronic
1147451384 17:40506977-40506999 AAAACTTTCCTCCCTCTCAGAGG - Intergenic
1148683815 17:49489624-49489646 AAAACTATCCTGCCTGTCCTTGG + Intergenic
1150315120 17:64162806-64162828 AGACCTATACTGCCTCTTTCAGG + Intronic
1203162078 17_GL000205v2_random:62470-62492 AAACCTAACCTTCCCCTCAGGGG + Intergenic
1203162186 17_GL000205v2_random:62900-62922 AAACCTAACCTTCCCCTCAGGGG + Intergenic
1203162461 17_GL000205v2_random:63984-64006 AAACCTAACCTTCCCCTCAAGGG + Intergenic
1203162572 17_GL000205v2_random:64422-64444 AAACCTAACCTTCCCCTCAGGGG + Intergenic
1153894554 18:9546524-9546546 AAACCTGCCCTGTTTCTCACAGG - Intergenic
1154142479 18:11836944-11836966 AAAGCTATCCTGGCTTTCATTGG - Intronic
1157319355 18:46622476-46622498 AGACATATCCTAACTCTCACCGG - Intronic
1157583111 18:48784657-48784679 ACACCTCTCCTGGCTCTCCCAGG - Intronic
1159991512 18:74914224-74914246 GAACCTCTCCTGGCCCTCACAGG - Intronic
1162135504 19:8552756-8552778 TTACCTATCCTGACTTTCACTGG + Intronic
1165646297 19:37441132-37441154 AATCCTCTCCTTCCTCTTACAGG + Intronic
1168368098 19:55806791-55806813 ATACCCTTCCTGCCTCACACTGG + Intronic
924970316 2:120576-120598 AAGGCAATCCTGCCACTCACAGG + Intergenic
925947263 2:8877235-8877257 AAGCTTATGCTGCATCTCACTGG - Intronic
926028921 2:9568713-9568735 AATACTAACCTGCCTCTGACAGG - Intergenic
926842655 2:17099598-17099620 AAAACTATCCTTGCTCTCACTGG + Intergenic
927640471 2:24842384-24842406 GACCCTCTCCTGCCCCTCACAGG - Exonic
927806013 2:26147420-26147442 AAATCTGTCCTGCCTCACACAGG + Intergenic
929153999 2:38773263-38773285 AAACCAATCCTCCCTCTCTGAGG + Intronic
934928203 2:98396892-98396914 AGACCTGTTCTGCCTCTCAAAGG + Exonic
938644418 2:133316383-133316405 AAACCTAGACTGCCTATCCCAGG + Intronic
940340135 2:152571399-152571421 AAACTGATGCTGCCTCTCACTGG + Intronic
940871980 2:158868049-158868071 AAACAGATTCTGCCTCTCAGGGG - Intergenic
942325650 2:174774888-174774910 AAACATACCCTGCATATCACGGG - Intergenic
945075184 2:206031675-206031697 AATCCAGTCCTGCCTCTCATCGG - Intronic
946431611 2:219629503-219629525 AACCCTACCCAGCCTCACACAGG - Intronic
948123016 2:235544696-235544718 AAACCAATGCTGCCTCTCACAGG + Intronic
948139872 2:235664644-235664666 AAACCAAGCTTGCTTCTCACTGG + Intronic
948715875 2:239862914-239862936 AAACTTAACATGCATCTCACCGG - Intergenic
1168805157 20:668400-668422 ATACCTATCCTGCAACTGACAGG + Intronic
1169379606 20:5095317-5095339 AAACCTATCCTGCCTCTCACTGG + Intronic
1169577217 20:6978083-6978105 AAAACTATTCTGCCTTTCTCAGG + Intergenic
1170209741 20:13836758-13836780 AAACTGTTCCTGCCTGTCACTGG + Intergenic
1172990384 20:39031740-39031762 AAGCCTGCCCTGACTCTCACTGG - Intronic
1175136758 20:56830013-56830035 AAACCTATCACGCCTCTCTGTGG - Intergenic
1176407688 21:6430380-6430402 AAATGTTTCCTGCCTCTCCCCGG + Intergenic
1179683178 21:43038711-43038733 AAATGTTTCCTGCCTCTCCCCGG + Intergenic
1180436150 22:15306504-15306526 AAACATAGCCTGTCTCACACAGG + Intergenic
1180955845 22:19740861-19740883 GAACCAATCCTGCCCCTCCCTGG + Intergenic
1181614897 22:24047189-24047211 AAATCTATCAGGGCTCTCACAGG - Intronic
1182768724 22:32777945-32777967 AAAACCATCCTGCGTCTCAGAGG + Intronic
1183414225 22:37673414-37673436 ACACCCACCCTGCCTCTCAGGGG - Intergenic
949165409 3:934885-934907 AAAGGTATCCTGCCACTCTCTGG - Intergenic
950602142 3:14044313-14044335 AAACCTATCCTGGCTTTTAAGGG + Intronic
952525004 3:34200705-34200727 AAATCTTTCCTGCATCTCAGTGG + Intergenic
956007569 3:64797300-64797322 AGACCTGTCTTGCCTCCCACAGG + Intergenic
962333667 3:134505502-134505524 AAGCCCATCCTGCCTGCCACTGG - Intronic
963837532 3:150072086-150072108 ACACCTCGGCTGCCTCTCACTGG + Intergenic
963871956 3:150426400-150426422 AAACCTATCCTGATGATCACTGG + Intronic
970410814 4:15806362-15806384 AAAGCAATGCTGCCTCCCACAGG - Intronic
970779165 4:19714719-19714741 AGACATACCCTGCCTCTCAATGG + Intergenic
974659843 4:64872724-64872746 AAAACTTTCCTCCCTCTGACTGG - Intergenic
977793733 4:101137472-101137494 AAACCTGTCCAGGCTCTCCCAGG + Intronic
980192537 4:129543434-129543456 TAAACTATCCTGCCACTCAAGGG + Intergenic
980816233 4:137950092-137950114 AAACCAATCCTAGTTCTCACTGG - Intergenic
982118030 4:152114023-152114045 TAACCTATCCTGTCTCACCCAGG + Intergenic
985852426 5:2398351-2398373 ACACCTGTCCTTCCCCTCACAGG - Intergenic
986167540 5:5288393-5288415 TATCTTTTCCTGCCTCTCACCGG - Intronic
986572285 5:9177718-9177740 AAAGACATCCTGCATCTCACAGG + Intronic
990722841 5:58717424-58717446 AAGCCTGTCCTGCCACCCACAGG + Intronic
993871359 5:93258024-93258046 AAACCTCTCCTGTATCTCAGTGG - Intergenic
998301013 5:141020348-141020370 AACCATAACCTGACTCTCACTGG - Intergenic
999622631 5:153488229-153488251 GAACCTATTCTGTATCTCACAGG - Intergenic
1001096444 5:168779180-168779202 AATACTATCCTACCTCTTACGGG - Intronic
1003960568 6:11205138-11205160 ATATCAATCCTGCCTCTCACTGG + Intronic
1005574868 6:27181395-27181417 AAACCTATCCTGGCTTCCAAGGG - Intergenic
1005574879 6:27181463-27181485 AAACCTATCCTGGCTTCCAAGGG - Intergenic
1005676089 6:28156825-28156847 AAACCTAACATGCCTCTCCCAGG - Exonic
1005892329 6:30150226-30150248 AAACCTACCCTGACTTTCCCAGG - Intergenic
1006096115 6:31657841-31657863 GAACCCATCCTGCCTCCCTCAGG - Intronic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1010365892 6:75050659-75050681 AAAGCCCTCCTGCCCCTCACAGG + Intergenic
1012024696 6:93973649-93973671 AATCCTTCCCTGCCTCTCCCCGG - Intergenic
1012418941 6:99040571-99040593 AAACCTATCCTTCATAGCACTGG + Intergenic
1013417744 6:109939779-109939801 AAGCCTATCCTGACTCACAGGGG - Intergenic
1013948845 6:115754838-115754860 AAACCTATCCTGGCTCTGAAGGG - Intergenic
1017058938 6:150462979-150463001 GAACCTCTCCTGCCTCTGGCAGG + Intergenic
1022239254 7:28493344-28493366 TAGCCTATCCTGCCTCAGACTGG - Intronic
1022473906 7:30698147-30698169 AAGCCCAGCCTTCCTCTCACGGG - Intronic
1025828567 7:65030863-65030885 TAACCCAACCTACCTCTCACTGG + Intergenic
1029889652 7:103914034-103914056 GCACCTAGCCTTCCTCTCACAGG - Intronic
1030979703 7:116171859-116171881 AAACCTCTACTGCTTTTCACAGG - Intergenic
1031454363 7:121961217-121961239 AAAGCCTCCCTGCCTCTCACTGG + Intronic
1037936497 8:22918392-22918414 AAACCCATCCTGCCTCAGCCCGG - Intronic
1039550017 8:38436629-38436651 AAACCTACCCTGCTTCTCTAAGG + Intronic
1040435613 8:47388101-47388123 AAACCTATACTGGGTCTCAGAGG - Intronic
1041386586 8:57310466-57310488 CAACCTCTCCAGCCTCTCAGAGG - Intergenic
1045563919 8:103294513-103294535 AAACATCTCCAGCCTATCACCGG - Intergenic
1047538634 8:125742979-125743001 AAACCCCTCCTGCTTGTCACAGG - Intergenic
1049423283 8:142526192-142526214 ACACCAATCCTGGCTCTCCCTGG - Intronic
1050361009 9:4831088-4831110 GGACCTACTCTGCCTCTCACTGG - Intronic
1050959944 9:11716933-11716955 AAGCCTCTCCTGTCTCTCTCAGG + Intergenic
1051251173 9:15160484-15160506 CAACCTTTCCTGCCTCACACTGG - Intergenic
1051330915 9:16024303-16024325 AATCCTATCCTACCTCAAACTGG + Intronic
1052525739 9:29616570-29616592 AAGCCTTTACTTCCTCTCACTGG - Intergenic
1057321098 9:94013596-94013618 AAAGCTATCTTGCCTCTCTGTGG - Intergenic
1060189220 9:121581714-121581736 CAGCCTCTCCTGCCTCTCCCTGG - Intronic
1060232609 9:121836775-121836797 TAACCTATCCTGCCTCTTCCAGG - Intronic
1187595460 X:20766923-20766945 AATACTATCTTGCCTCACACTGG + Intergenic
1188080541 X:25834179-25834201 ACTACTATCCTGCCTCTAACTGG - Intergenic
1189948666 X:46206008-46206030 AAATCTGTCCTGCCTATCAGTGG + Intergenic
1190432036 X:50387469-50387491 AAAGCAAACATGCCTCTCACTGG - Intronic
1190763845 X:53459705-53459727 AAACCTCACCAGACTCTCACTGG + Intergenic
1194673216 X:96761325-96761347 AAACCAATGCTGCCTCTCAATGG - Intronic
1198985964 X:142454200-142454222 AAACATATACTGCTTCTCAATGG + Intergenic
1199298612 X:146187004-146187026 AAACCACTCCTGACCCTCACAGG - Intergenic
1200801979 Y:7395145-7395167 AAACCTATCCTGGCTTCCAAGGG - Intergenic