ID: 1169381825

View in Genome Browser
Species Human (GRCh38)
Location 20:5113740-5113762
Sequence ATTTCCATCTAGATTGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169381825_1169381829 5 Left 1169381825 20:5113740-5113762 CCATCACCAATCTAGATGGAAAT No data
Right 1169381829 20:5113768-5113790 CATCACCCCAAAGTTCCATCGGG No data
1169381825_1169381828 4 Left 1169381825 20:5113740-5113762 CCATCACCAATCTAGATGGAAAT No data
Right 1169381828 20:5113767-5113789 CCATCACCCCAAAGTTCCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169381825 Original CRISPR ATTTCCATCTAGATTGGTGA TGG (reversed) Intergenic
No off target data available for this crispr