ID: 1169382374

View in Genome Browser
Species Human (GRCh38)
Location 20:5119482-5119504
Sequence CACGCCAGCCAATGAGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 110}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169382369_1169382374 0 Left 1169382369 20:5119459-5119481 CCAATGAGAAGGCGCGGATGGCC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1169382374 20:5119482-5119504 CACGCCAGCCAATGAGGGCTAGG 0: 1
1: 0
2: 0
3: 2
4: 110
1169382362_1169382374 20 Left 1169382362 20:5119439-5119461 CCACCCCACTGCGTGGCAGGCCA 0: 1
1: 0
2: 1
3: 10
4: 184
Right 1169382374 20:5119482-5119504 CACGCCAGCCAATGAGGGCTAGG 0: 1
1: 0
2: 0
3: 2
4: 110
1169382364_1169382374 16 Left 1169382364 20:5119443-5119465 CCCACTGCGTGGCAGGCCAATGA 0: 1
1: 0
2: 1
3: 5
4: 108
Right 1169382374 20:5119482-5119504 CACGCCAGCCAATGAGGGCTAGG 0: 1
1: 0
2: 0
3: 2
4: 110
1169382360_1169382374 22 Left 1169382360 20:5119437-5119459 CCCCACCCCACTGCGTGGCAGGC 0: 1
1: 0
2: 4
3: 30
4: 338
Right 1169382374 20:5119482-5119504 CACGCCAGCCAATGAGGGCTAGG 0: 1
1: 0
2: 0
3: 2
4: 110
1169382361_1169382374 21 Left 1169382361 20:5119438-5119460 CCCACCCCACTGCGTGGCAGGCC 0: 1
1: 0
2: 2
3: 26
4: 207
Right 1169382374 20:5119482-5119504 CACGCCAGCCAATGAGGGCTAGG 0: 1
1: 0
2: 0
3: 2
4: 110
1169382365_1169382374 15 Left 1169382365 20:5119444-5119466 CCACTGCGTGGCAGGCCAATGAG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1169382374 20:5119482-5119504 CACGCCAGCCAATGAGGGCTAGG 0: 1
1: 0
2: 0
3: 2
4: 110
1169382363_1169382374 17 Left 1169382363 20:5119442-5119464 CCCCACTGCGTGGCAGGCCAATG 0: 1
1: 0
2: 1
3: 4
4: 82
Right 1169382374 20:5119482-5119504 CACGCCAGCCAATGAGGGCTAGG 0: 1
1: 0
2: 0
3: 2
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169382374 Original CRISPR CACGCCAGCCAATGAGGGCT AGG Intronic
900578668 1:3396694-3396716 CAAGCCACCTAATGAGGGCCAGG + Intronic
900652525 1:3736933-3736955 CACGTCCACCAAGGAGGGCTGGG + Intergenic
902651981 1:17843134-17843156 CAAGCCAGCCAAAGAAAGCTGGG - Intergenic
903938600 1:26913503-26913525 CACCGCAGCCAGGGAGGGCTGGG + Exonic
904014549 1:27409732-27409754 CACGGCAGGCAAGGAGGACTTGG + Exonic
905279743 1:36841542-36841564 CAAGGCAGCCCATGAGAGCTGGG + Intronic
905995947 1:42380722-42380744 CCCGCCAGCCAATCAGCGCGCGG - Intergenic
906297080 1:44655450-44655472 CACTCCAGGCCAAGAGGGCTTGG - Intronic
912401641 1:109398050-109398072 GACGCGAGCCAATGAGGAGTGGG - Intergenic
913212028 1:116589881-116589903 CAGTCCACCCCATGAGGGCTGGG - Intronic
922790042 1:228306295-228306317 CAGGCCAGCAGATGAGGGCCTGG - Intronic
1065188681 10:23192226-23192248 CGCGCCAGCCAATCAGAGCGCGG - Intergenic
1067211246 10:44261739-44261761 CAGCCCAGCCAATGATGGCAAGG - Intergenic
1069888712 10:71639601-71639623 CACAGCAGCCAAGGAAGGCTTGG - Intronic
1070796710 10:79221141-79221163 CAGGCCAGCCAAGGAGGGCCAGG + Intronic
1075380350 10:122013682-122013704 CTCCCCAGCCACAGAGGGCTCGG - Intronic
1075870614 10:125770409-125770431 CAGGCCAGCCAGTGAGGATTTGG + Exonic
1080396483 11:31894691-31894713 CACCTCAGACAATGTGGGCTGGG + Intronic
1083812062 11:65111788-65111810 CACACCAGCCAATCGGCGCTCGG - Exonic
1083881457 11:65551019-65551041 CACGCTAGCCTATTAGCGCTAGG + Intronic
1088824796 11:113484404-113484426 CATGCCAGCCGAGGAGGGCGGGG + Intergenic
1088980384 11:114857989-114858011 CAGGCTAGCAGATGAGGGCTTGG + Intergenic
1092195628 12:6548184-6548206 GAGGCCAGCCAAGGAGGGATGGG + Intronic
1095526707 12:43134714-43134736 CCCGGCAGCCATTGAGGTCTGGG + Intergenic
1103760904 12:123249626-123249648 CTCGCGGGCCAGTGAGGGCTTGG - Intronic
1103764065 12:123269612-123269634 CACGCCAGACAAAGAGCGCGGGG + Intronic
1104623919 12:130337846-130337868 CGGGGCAGCCAATGAGGGCGTGG + Intergenic
1104950776 12:132438968-132438990 CTCGACAGCCCCTGAGGGCTCGG + Intergenic
1105378199 13:19863696-19863718 CTCGCCAGCCAACGAGCGCACGG - Intergenic
1105389034 13:19958656-19958678 CCCGTCAGCCAATGAGCGCGCGG + Exonic
1106208182 13:27619011-27619033 CATGCCAGCCATTGATGGCGGGG - Intronic
1106294075 13:28394234-28394256 TATTCCAGGCAATGAGGGCTTGG + Intronic
1111950777 13:94707516-94707538 CGCGCCAGCCAATCAGAGCGCGG - Intergenic
1118319123 14:64743048-64743070 CTCCCCAGCCGAGGAGGGCTTGG - Exonic
1119772837 14:77231782-77231804 CAGGCAAGCCAGTCAGGGCTGGG + Intronic
1123666165 15:22610710-22610732 CACCCCATCCAAGAAGGGCTGGG - Intergenic
1124210845 15:27763979-27764001 CAACCCAGCCACTGAGGGGTGGG + Intronic
1124319988 15:28705116-28705138 CACCCCATCCAAGAAGGGCTGGG - Intronic
1124482523 15:30090301-30090323 CACCCCATCCAAGAAGGGCTGGG + Intronic
1124488980 15:30142403-30142425 CACCCCATCCAAGAAGGGCTGGG + Intronic
1124521051 15:30406908-30406930 CACCCCATCCAAGAAGGGCTGGG - Intronic
1124537611 15:30559312-30559334 CACCCCATCCAAGAAGGGCTGGG + Intronic
1124544066 15:30611367-30611389 CACCCCATCCAAGAAGGGCTGGG + Intronic
1124564030 15:30798802-30798824 CACCCCATCCAAAAAGGGCTGGG + Intergenic
1124754550 15:32395920-32395942 CACCCCATCCAAGAAGGGCTGGG - Intronic
1124761045 15:32448275-32448297 CACCCCATCCAAGAAGGGCTGGG - Intronic
1124777589 15:32600788-32600810 CACCCCATCCAAGAAGGGCTGGG + Intronic
1129038087 15:72663126-72663148 CACCCCATCCAAGAAGGGCTGGG + Intronic
1129211803 15:74074105-74074127 CACCCCATCCAAGAAGGGCTGGG - Intronic
1129398600 15:75266979-75267001 CACCCCATCCAAGAAGGGCTGGG + Intronic
1129402208 15:75291255-75291277 CACCCCATCCAAGAAGGGCTGGG + Intronic
1129728926 15:77918377-77918399 CACCCCATCCAAGAAGGGCTGGG - Intergenic
1129839586 15:78735484-78735506 CACCCCATCCAAGAAGGGCTGGG + Intergenic
1131068377 15:89448692-89448714 CACACCAGCCCATCAGGGATAGG + Intergenic
1131672280 15:94632342-94632364 CACGACAGACACTGAGAGCTAGG - Intergenic
1131699235 15:94915959-94915981 AACACCAGCCAATTAGGGCCTGG + Intergenic
1132292593 15:100713845-100713867 GACGGAAGCCAAAGAGGGCTAGG + Intergenic
1132635859 16:946197-946219 CAGGCCAGCCAGGGAGGGCAAGG + Intronic
1137633801 16:49967942-49967964 CACGCCAGTCACTGAGAGCTGGG - Intergenic
1143679982 17:8469237-8469259 CAATCCTTCCAATGAGGGCTGGG - Intronic
1149988548 17:61367089-61367111 TTCGCCAGGCAGTGAGGGCTGGG - Intronic
1152337328 17:79706290-79706312 CCCGCAAGCCCATCAGGGCTGGG + Intergenic
1152504411 17:80738132-80738154 CACGCCTGCCAGTGGGTGCTGGG + Intronic
1157609802 18:48949379-48949401 CAGGCCCGCCAAGGAAGGCTGGG - Intronic
1161606342 19:5216836-5216858 TCCGCCAGCCAGTGAGGGGTGGG - Intronic
1162583660 19:11546081-11546103 CACGCCTGCCAGTGAGGCTTCGG + Intronic
1163148944 19:15399950-15399972 GACACCAGCCACTGAGGACTTGG + Intronic
1166459554 19:42974133-42974155 CCCTCCAGCCAATGAGTGTTGGG - Intronic
935196040 2:100817468-100817490 AACACCAGCCAAATAGGGCTAGG - Intergenic
936525641 2:113239852-113239874 CAAGCAAGACAAGGAGGGCTTGG - Intronic
936586492 2:113762933-113762955 CATGCCAGCCAACTAGGGCATGG + Intergenic
937283530 2:120736195-120736217 CGCGCCAGCCAAGGTGGGATGGG + Intronic
947825726 2:233105034-233105056 CAAGACAGCCAATGGGGGCCTGG - Intronic
948015535 2:234687772-234687794 CACCACAGCCCATGAGGCCTAGG - Intergenic
1169382374 20:5119482-5119504 CACGCCAGCCAATGAGGGCTAGG + Intronic
1171348655 20:24486100-24486122 CACGCCTGTCACTGAGAGCTGGG - Intronic
1172007176 20:31825462-31825484 CATGTCAGCCCATGAGGGCAGGG - Intronic
1175641485 20:60634019-60634041 CTCACCAGCCAGCGAGGGCTGGG + Intergenic
1175817641 20:61891741-61891763 CACGGCAGCCAATCAGGGTCTGG - Intronic
1181013872 22:20057325-20057347 CACCCTAGCAAATGGGGGCTGGG - Intronic
955371847 3:58358534-58358556 CACACCAGCCCATGGAGGCTTGG - Intronic
961002017 3:123380337-123380359 AACGCCAGCTACTCAGGGCTTGG - Intronic
968425107 4:518063-518085 CTGGCCAGCCAAGGAGTGCTTGG + Intronic
969107751 4:4820633-4820655 CACCCCAGCCACAGAGGCCTTGG + Intergenic
969464753 4:7349610-7349632 TTCGCCACCCAGTGAGGGCTTGG + Intronic
982001092 4:151021953-151021975 AACCCCAGAGAATGAGGGCTAGG - Intergenic
1006444736 6:34073904-34073926 CACCCCAGCCAGTGAGGACCAGG - Intronic
1009479993 6:64144704-64144726 CACTACAGCCAGGGAGGGCTGGG + Intronic
1011557841 6:88588105-88588127 TCTTCCAGCCAATGAGGGCTGGG + Intergenic
1017936675 6:159011671-159011693 CACGACCGCCAAGGATGGCTCGG - Intergenic
1024766754 7:52669068-52669090 CACCCCAACCACAGAGGGCTCGG + Intergenic
1026869699 7:73842654-73842676 CCCGCCAGCCAATGAGCTCAAGG + Intergenic
1026896825 7:74014161-74014183 CTCACCAGCGAGTGAGGGCTTGG + Intergenic
1032783446 7:135182650-135182672 CACCCCAGCCCATGAGACCTGGG - Intergenic
1035232741 7:157476262-157476284 CACACCAGCCACTGAGTGCCTGG + Intergenic
1035277209 7:157754696-157754718 CACGCATGCCAAGTAGGGCTGGG - Intronic
1036310170 8:7679880-7679902 CAGTCCAGCCAAGCAGGGCTTGG + Intergenic
1037523908 8:19706425-19706447 CACGGCAGCCCATGAGGTCAAGG + Intronic
1040109220 8:43559070-43559092 CCTGCCAGCCAAGGAGGCCTCGG - Intergenic
1040877899 8:52172027-52172049 AACGTCAGGGAATGAGGGCTGGG + Exonic
1047204026 8:122789111-122789133 CTCGCCAGCCAATGGGGGAAGGG + Intronic
1049427168 8:142542671-142542693 CACCCCAGCCAGCGAGGGCAGGG + Intronic
1053409290 9:37905097-37905119 CACGCCAGCCAAAGTGGGGCTGG - Intronic
1058274277 9:103021119-103021141 CCCACCAGACAATGTGGGCTGGG + Intergenic
1061133694 9:128721800-128721822 CACAGCAGCCCCTGAGGGCTCGG - Exonic
1061532833 9:131228365-131228387 CACGCCAGCCAAAAAGCACTAGG + Intronic
1186186927 X:7029786-7029808 CCCTCCAGCCAATGAGTGTTGGG - Intergenic
1189347427 X:40252619-40252641 CACCCCAGCAGAAGAGGGCTGGG + Intergenic
1192788077 X:74354181-74354203 CAAGCCAGCCACTGTGGCCTCGG + Intergenic
1193286564 X:79721805-79721827 CACTCCAGCCAAAGAAGGCAAGG - Intergenic
1197724654 X:129768458-129768480 CACTCCAGCCAAGGATGGCAAGG - Exonic
1199727743 X:150601677-150601699 CAGACCAGGCAAGGAGGGCTAGG - Intronic
1199843648 X:151675306-151675328 CAGGGCAGGCAGTGAGGGCTGGG - Intronic