ID: 1169383262

View in Genome Browser
Species Human (GRCh38)
Location 20:5127000-5127022
Sequence CACGCGCGGACTCCCACGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169383262_1169383272 23 Left 1169383262 20:5127000-5127022 CCGGCCGTGGGAGTCCGCGCGTG 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1169383272 20:5127046-5127068 GCGGCTTCGCTGCTAGCTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 33
1169383262_1169383267 1 Left 1169383262 20:5127000-5127022 CCGGCCGTGGGAGTCCGCGCGTG 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1169383267 20:5127024-5127046 CCGCGCCGAGCTGCCTGCTCCGG 0: 1
1: 0
2: 0
3: 6
4: 125
1169383262_1169383268 4 Left 1169383262 20:5127000-5127022 CCGGCCGTGGGAGTCCGCGCGTG 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1169383268 20:5127027-5127049 CGCCGAGCTGCCTGCTCCGGCGG 0: 1
1: 0
2: 1
3: 5
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169383262 Original CRISPR CACGCGCGGACTCCCACGGC CGG (reversed) Exonic
901483086 1:9539543-9539565 CGCGCGCGGGCTCCAACGCCCGG - Exonic
903324691 1:22563315-22563337 CACGCCCACACTCCCCCGGCGGG - Intergenic
912429111 1:109619911-109619933 CAGGGTCGGACTCCCGCGGCCGG - Intronic
914828405 1:151152555-151152577 CAGGCGCGCACCCCCACGCCCGG - Intergenic
917904600 1:179576077-179576099 CGCCCGCCGACTCCCACGGCCGG + Intergenic
922581774 1:226703544-226703566 CACGCGCGGAAGCCCGCGGCCGG + Intronic
923276738 1:232403257-232403279 CAAGAGCGGTCTCCCACAGCAGG + Intronic
924689002 1:246326494-246326516 CAGGCGCGAACTGCCACGCCCGG - Intronic
1077508217 11:2941848-2941870 CACCCGCGGACCCACACGCCAGG + Intergenic
1079105557 11:17570115-17570137 CCCGCTCAGACTCCCACGCCCGG - Intronic
1082205996 11:49434566-49434588 CGCGCGCGGGCTCCAACGCCCGG + Intergenic
1083318225 11:61829017-61829039 CAAGCGCGGAGTCCCACACCTGG - Intronic
1084056243 11:66635456-66635478 CAGGCGCACACTTCCACGGCTGG - Intronic
1085922733 11:80978359-80978381 CACATGCTGAATCCCACGGCTGG + Intergenic
1088598429 11:111456433-111456455 CATGCGGGGACTCCCTTGGCTGG - Intronic
1089545465 11:119221099-119221121 CAGGCGCGCACTACCACGCCCGG - Intronic
1093877796 12:24370647-24370669 CACGCGCGTGCCCCCACGCCTGG - Intergenic
1096179375 12:49542257-49542279 CACTCGCGTACTCCCAGTGCTGG + Intronic
1101606202 12:106248550-106248572 CACCCGCTGACTCCCACTCCCGG - Intronic
1104570258 12:129918663-129918685 CACGTGCCCAGTCCCACGGCAGG - Intergenic
1113961526 13:114128820-114128842 CAGGCCCGGCCTCCCACGGACGG + Intronic
1115746546 14:36443776-36443798 CACGCCCGACCTCCCACGCCAGG + Intergenic
1119753437 14:77097764-77097786 CACGCCCGCTCTCCCACGCCGGG + Intergenic
1132694226 16:1194862-1194884 CACGCGCGCACACCCGTGGCGGG + Intronic
1142235199 16:88918762-88918784 CCAGCCCGGCCTCCCACGGCAGG + Intronic
1142843112 17:2649429-2649451 CAGGCGCGCACCACCACGGCTGG - Intronic
1145126426 17:20303808-20303830 CACGCGCCCACTACCACGCCTGG - Intronic
1146126750 17:30237009-30237031 CCCGCGCGGACTCCACCCGCTGG - Intergenic
1148578622 17:48728244-48728266 CCCGCGGAGACTCCCACGGCCGG - Exonic
1148697453 17:49569855-49569877 CAGGCGCGCGCTCCCACGCCCGG + Intergenic
1149512655 17:57256321-57256343 CACACTCGGCCCCCCACGGCCGG - Intronic
1154940425 18:21107909-21107931 CACGCGTGCACTACCACGCCTGG - Intronic
1155166151 18:23234073-23234095 CAGGCGCGCACCACCACGGCCGG - Intronic
1160452403 18:78974342-78974364 CACGCGCGCACTCGCACGGACGG + Intergenic
1160538269 18:79606933-79606955 CACGCGGGGACTCTGAGGGCGGG - Intergenic
1161541516 19:4854544-4854566 CAGGCGTGCACTGCCACGGCCGG + Intronic
1162512837 19:11130059-11130081 CAGGCGCCCACTCCCACGCCTGG - Intronic
1163158087 19:15449763-15449785 CACCCGCGGGCTCCCCAGGCCGG + Intronic
1166917847 19:46207912-46207934 CAAGGGAGGACTCCCACTGCAGG + Intergenic
1166920155 19:46223726-46223748 CAAGGGAGGACTCCCACTGCAGG + Intergenic
925445209 2:3921221-3921243 CATGCGGGGACGCCCACAGCAGG + Intergenic
926478031 2:13352443-13352465 CAGGCACGCACTACCACGGCCGG + Intergenic
936561276 2:113541775-113541797 CGCTCGCTGACTCCCTCGGCAGG - Intergenic
937854857 2:126664830-126664852 CACGGGAGGACTCCCTGGGCTGG + Intronic
938422495 2:131155930-131155952 CAGGCGCTGCCTCCCAAGGCTGG - Intronic
945898749 2:215514690-215514712 GACGCGCAGCCACCCACGGCAGG - Intergenic
945898759 2:215514748-215514770 CACGCACAGCCACCCACGGCGGG - Intergenic
945898766 2:215514778-215514800 CACGCACAGCCACCCACGGCAGG - Intergenic
947747100 2:232513463-232513485 CACTTGTGGACTCCCAAGGCAGG + Intergenic
1169383262 20:5127000-5127022 CACGCGCGGACTCCCACGGCCGG - Exonic
1179133568 21:38660558-38660580 CACGCGCGGACACACACGTGCGG - Intronic
1180994400 22:19958305-19958327 CACGTGCGGACCACCACGCCTGG + Intronic
1181913155 22:26256622-26256644 CTCTCGTGGACTTCCACGGCTGG + Intronic
1184176075 22:42789835-42789857 CAGGCGCGCACTGCCACGCCAGG - Intergenic
1185225344 22:49648754-49648776 GACACGCGGACTCCCAGGGGCGG - Intronic
953246652 3:41199629-41199651 GACGGTCGGACTCCCGCGGCGGG + Exonic
968416371 4:438104-438126 CAGGCGCCCACTCCCACGCCTGG - Intronic
976897173 4:90127246-90127268 GACGCGCGCACACCCACTGCTGG - Intergenic
979247170 4:118520729-118520751 CAGGCGCGCACTACCACGCCTGG + Intergenic
985675802 5:1230719-1230741 CAGGCGCGGAGACGCACGGCGGG + Intronic
988533319 5:32043768-32043790 CACGCGCAGGCTACCACGCCTGG + Intronic
989042245 5:37240991-37241013 CAGGTGCGCACCCCCACGGCTGG - Intronic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
1002597923 5:180336077-180336099 CCTGCGCGGACTCCCAGGGTGGG - Intronic
1004174021 6:13323208-13323230 CAGGCGCGCACCCCCACGCCCGG - Intronic
1005615328 6:27567128-27567150 CAGGCGCGTACCACCACGGCCGG - Intergenic
1006227969 6:32556652-32556674 CAGGCGCGCACCCCCACGGTCGG - Intronic
1007241945 6:40432603-40432625 GTCGCACGGAGTCCCACGGCAGG + Exonic
1015722153 6:136253723-136253745 CACGCGCTGGCCACCACGGCAGG - Intergenic
1019449219 7:1088158-1088180 CCCTCGCGGGCTCCCAGGGCGGG + Intronic
1022923441 7:35037759-35037781 CACGCGCGGACTTCCGGCGCAGG + Intronic
1035169234 7:157008839-157008861 CACACGCGGACTCTCCGGGCTGG - Intronic
1038475580 8:27864268-27864290 CACGTGCAGACTCCCAGGGCGGG + Intergenic
1038554038 8:28494276-28494298 GACGCGCGGCCGCCCGCGGCAGG + Exonic
1042550358 8:69989140-69989162 CAGGCGTGGACTGCCACGCCTGG - Intergenic
1049789491 8:144466287-144466309 CACGGCCCGGCTCCCACGGCTGG - Exonic
1049891413 9:73564-73586 CGCTCGCTGACTCCCCCGGCAGG + Intergenic
1058150450 9:101458035-101458057 CAGGCGCGCACTACCACGCCCGG + Intergenic
1061303465 9:129719438-129719460 CACGCGCACGCTCCCACGGGAGG - Intronic
1062365852 9:136208717-136208739 CACCCGGGCACTCACACGGCCGG + Exonic
1062587355 9:137255337-137255359 CGCGCGCGGAGTCGCGCGGCGGG + Exonic
1188374579 X:29412126-29412148 CAGGCGCGGACCACCACGCCTGG - Intronic
1192811466 X:74550694-74550716 CAGGCGCGCACCACCACGGCCGG - Intergenic
1200093652 X:153647391-153647413 CACGCGCGGTCGTCCACCGCCGG + Exonic
1200256328 X:154585039-154585061 CACTCGGGGTCTCCCAGGGCCGG + Intergenic
1200261441 X:154619364-154619386 CACTCGGGGTCTCCCAGGGCCGG - Intergenic
1200267424 X:154653661-154653683 CACTCGGGGTCTCCCAGGGCCGG - Intergenic