ID: 1169383262

View in Genome Browser
Species Human (GRCh38)
Location 20:5127000-5127022
Sequence CACGCGCGGACTCCCACGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169383262_1169383267 1 Left 1169383262 20:5127000-5127022 CCGGCCGTGGGAGTCCGCGCGTG 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1169383267 20:5127024-5127046 CCGCGCCGAGCTGCCTGCTCCGG 0: 1
1: 0
2: 0
3: 6
4: 125
1169383262_1169383272 23 Left 1169383262 20:5127000-5127022 CCGGCCGTGGGAGTCCGCGCGTG 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1169383272 20:5127046-5127068 GCGGCTTCGCTGCTAGCTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 33
1169383262_1169383268 4 Left 1169383262 20:5127000-5127022 CCGGCCGTGGGAGTCCGCGCGTG 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1169383268 20:5127027-5127049 CGCCGAGCTGCCTGCTCCGGCGG 0: 1
1: 0
2: 1
3: 5
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169383262 Original CRISPR CACGCGCGGACTCCCACGGC CGG (reversed) Exonic