ID: 1169385012

View in Genome Browser
Species Human (GRCh38)
Location 20:5141338-5141360
Sequence CATTAGATGCACACATTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 120}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169385012_1169385014 2 Left 1169385012 20:5141338-5141360 CCATGCAATGTGTGCATCTAATG 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1169385014 20:5141363-5141385 GTCTCTATAAAAGGCTTTAGAGG 0: 1
1: 0
2: 0
3: 15
4: 144
1169385012_1169385013 -7 Left 1169385012 20:5141338-5141360 CCATGCAATGTGTGCATCTAATG 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1169385013 20:5141354-5141376 TCTAATGAAGTCTCTATAAAAGG 0: 1
1: 4
2: 26
3: 55
4: 256
1169385012_1169385015 7 Left 1169385012 20:5141338-5141360 CCATGCAATGTGTGCATCTAATG 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1169385015 20:5141368-5141390 TATAAAAGGCTTTAGAGGACAGG 0: 1
1: 0
2: 0
3: 23
4: 271
1169385012_1169385016 8 Left 1169385012 20:5141338-5141360 CCATGCAATGTGTGCATCTAATG 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1169385016 20:5141369-5141391 ATAAAAGGCTTTAGAGGACAGGG 0: 1
1: 0
2: 2
3: 48
4: 324
1169385012_1169385018 15 Left 1169385012 20:5141338-5141360 CCATGCAATGTGTGCATCTAATG 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1169385018 20:5141376-5141398 GCTTTAGAGGACAGGGTTCAGGG 0: 1
1: 0
2: 2
3: 23
4: 208
1169385012_1169385017 14 Left 1169385012 20:5141338-5141360 CCATGCAATGTGTGCATCTAATG 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1169385017 20:5141375-5141397 GGCTTTAGAGGACAGGGTTCAGG 0: 1
1: 0
2: 3
3: 26
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169385012 Original CRISPR CATTAGATGCACACATTGCA TGG (reversed) Intronic
902401598 1:16160733-16160755 CCTTAGATGCTCACATTTGATGG + Intergenic
907574645 1:55515053-55515075 CAGAAAAGGCACACATTGCAAGG + Intergenic
914770418 1:150679206-150679228 AATTAGATGCATACATAGAATGG + Intronic
916639565 1:166712377-166712399 CAATAGATGCACAGATATCAAGG + Intergenic
918809719 1:189100364-189100386 CATTAGAACCACACATATCAAGG + Intergenic
919707527 1:200692020-200692042 CATTAGAGACACACAATACATGG - Intergenic
920687770 1:208122624-208122646 CGTGAGATGCACCCATTGGATGG + Intronic
923760058 1:236834000-236834022 CATTTGACCCACACATTGTATGG + Intronic
924113264 1:240721329-240721351 CAAGATATGCACCCATTGCAGGG - Intergenic
924203810 1:241689630-241689652 AATCAGATGCAGACATGGCAAGG + Intronic
1065763141 10:29001911-29001933 CACCAGAAGCACACAATGCAAGG + Intergenic
1067966152 10:50915143-50915165 CATGAGATGCAGACATTGCTTGG + Intergenic
1071762011 10:88618531-88618553 CTTTAGAACCACATATTGCAGGG - Intergenic
1072140489 10:92585095-92585117 AAGTAGATGCACACATTGGCTGG + Intergenic
1079052838 11:17178261-17178283 CATAATATGCACAGATTTCAAGG - Intronic
1079782681 11:24627887-24627909 AAATATATGCACACATTGAAGGG - Intronic
1081416830 11:42825618-42825640 GATTAGATGCACACATGGCAAGG + Intergenic
1086634349 11:89063853-89063875 CAACAGATGCTCACATGGCAAGG + Intronic
1093176581 12:15919490-15919512 CAAAAGATGAACACATTTCAAGG - Intronic
1094370408 12:29731426-29731448 AATTATATGCCCACAATGCACGG + Intronic
1095334660 12:41010790-41010812 CATTTAATGCACATATTGGAGGG - Intronic
1100098264 12:91070719-91070741 GACCAGATGGACACATTGCAAGG - Intergenic
1101642255 12:106595522-106595544 GATGAAAGGCACACATTGCATGG - Intronic
1103070246 12:117935418-117935440 CATGAAATGAACACATTGGAGGG - Intronic
1103194414 12:119029818-119029840 GATTAAATGCAGACATGGCAGGG + Intronic
1104101511 12:125617239-125617261 CATAAGGTGCTCACATTGGAAGG - Intronic
1106669786 13:31892282-31892304 CGTGAGATGCACACATGGAAAGG + Intergenic
1106924998 13:34604765-34604787 CATTAGATGGGCACTATGCATGG + Intergenic
1107002618 13:35567375-35567397 CATAAAATACACACATTGTAGGG + Intronic
1107145918 13:37060112-37060134 CATTACTAGCACACATTGTAAGG + Intergenic
1107428849 13:40320447-40320469 CATTAGATGAACAGATAGCCAGG + Intergenic
1111968564 13:94886041-94886063 CATTAAATGCACTGATTCCAAGG - Intergenic
1117102155 14:52360913-52360935 CACTAGATTAACACATGGCAGGG - Intergenic
1118253482 14:64184270-64184292 CATTAGCTCCACACATGGCAGGG - Intronic
1120490034 14:85165631-85165653 CATTAGAGGCACAAAATGTATGG + Intergenic
1139223837 16:65214668-65214690 CATTATATGAACATATAGCAAGG + Intergenic
1140924507 16:79569592-79569614 CATCAGAATCACACATTGCATGG - Intergenic
1141382998 16:83592559-83592581 CAGAAGATGCACACATTGCCTGG + Intronic
1141881796 16:86865166-86865188 CATAAAATGCACACATGGAAAGG - Intergenic
1144773827 17:17774219-17774241 GATTAAATGCCCACCTTGCAGGG - Intronic
1146547338 17:33750302-33750324 CCTTAAATGAACAGATTGCAAGG + Intronic
1156184448 18:34645407-34645429 CATTACCTGCCCACATTACAAGG - Intronic
1157108350 18:44796024-44796046 GATTAGAAGCACAAATTGGAAGG - Intronic
1157812297 18:50705911-50705933 CATGAGGTGCACACTTTGGATGG - Intronic
1158836829 18:61339649-61339671 CATCAGATGTATCCATTGCATGG - Intronic
1159837610 18:73357918-73357940 GATTAAATGCACACATAGGAAGG + Intergenic
1165070822 19:33253948-33253970 CATTAGGTGCAGACAATGAAAGG - Intergenic
925230306 2:2227055-2227077 AATCAGAAGCACACATTTCAAGG - Intronic
929182188 2:39053483-39053505 CTTTAAATGGACACACTGCATGG - Intronic
930561024 2:52960013-52960035 CACTAGATTCACACATATCAGGG - Intergenic
932267274 2:70378535-70378557 CTTTAAATGGACAAATTGCATGG - Intergenic
932967724 2:76497177-76497199 CATTATATGCAGATATTTCAGGG - Intergenic
934695914 2:96400038-96400060 CTTCAGCTGCACACATTGCCAGG - Intergenic
939417553 2:141920218-141920240 CATTTGAGTCACACATTGCCAGG + Intronic
940265695 2:151833588-151833610 AATTACATCCACAGATTGCAAGG + Exonic
942960366 2:181823017-181823039 TGTTACATGCACAGATTGCATGG + Intergenic
948440390 2:237983438-237983460 CATTAAATGCACTCATTCTAGGG - Intronic
1169385012 20:5141338-5141360 CATTAGATGCACACATTGCATGG - Intronic
1170127351 20:12979132-12979154 CATGAGTTACACACAGTGCAAGG - Intergenic
1172853720 20:37984895-37984917 TGTTACATGGACACATTGCAGGG - Intronic
1173243151 20:41316089-41316111 CATGACAGGCAAACATTGCATGG - Intronic
1174180570 20:48671896-48671918 AAGTGGATGGACACATTGCATGG + Intronic
1179731798 21:43372413-43372435 CAATAGATACCCACATGGCAGGG - Intergenic
949608334 3:5678036-5678058 AATTCGATGAACACATTGCCTGG + Intergenic
954021395 3:47745318-47745340 CATTATACACACACATTTCATGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
963427702 3:145153498-145153520 CATTACAACCACACATAGCATGG - Intergenic
964087716 3:152836658-152836680 CATTGAAAGCACACATTGCTGGG - Exonic
964804600 3:160594513-160594535 AATTAGATGGACAAATTGGATGG + Intergenic
964971653 3:162570778-162570800 TATTAGGTGCAATCATTGCAGGG - Intergenic
965867827 3:173226962-173226984 CATTATATGAAAACAGTGCATGG - Intergenic
966882471 3:184358123-184358145 CATTCGATGCACCCATTTCAGGG + Intronic
968558899 4:1265917-1265939 CATTTTATGCACACATGGAATGG + Intergenic
970975830 4:22041835-22041857 CAGTAGATCCAAGCATTGCAGGG + Intergenic
972157358 4:36180966-36180988 CTCAGGATGCACACATTGCACGG - Intronic
972599785 4:40561942-40561964 CATTAGAGGTCCACAATGCAAGG + Intronic
972958431 4:44421315-44421337 AATGAGATGCACACACTCCAGGG - Intronic
973815655 4:54616776-54616798 CATTATATCCTCACATGGCAGGG - Intergenic
973972373 4:56226272-56226294 CATTAGATGGGCACATTGTTTGG + Intronic
973994084 4:56439152-56439174 CATTAGATACAAACTTTGCCCGG + Intronic
974175613 4:58318189-58318211 CATGAGATTCACACATTGTAAGG - Intergenic
980314018 4:131173025-131173047 AATTAGATGCATACATTTTAAGG + Intergenic
983426374 4:167588965-167588987 CATTACATGATCCCATTGCATGG + Intergenic
986124131 5:4869660-4869682 CATTAAGTGCACAGATTGCTGGG - Intergenic
986227040 5:5825572-5825594 CATTAGATGAATACATCACATGG - Intergenic
989447031 5:41541990-41542012 CATTAGGTGCACTCACTGCCAGG - Intergenic
992819427 5:80481207-80481229 CACTAGTGGCAGACATTGCAGGG + Intergenic
994785209 5:104151048-104151070 TATAATATGCACAGATTGCATGG - Intergenic
995153922 5:108886850-108886872 CATTAAATGCAGACATTGGTAGG + Intronic
999260031 5:150232643-150232665 GAATAGATGAACACATTGCCAGG + Intronic
999649520 5:153751667-153751689 CATTAGAAGCACACATTTAAAGG + Intronic
999841942 5:155437617-155437639 CATTACATGCCCAAAGTGCAAGG + Intergenic
1004274497 6:14223308-14223330 CATTCGATGTCCACATAGCAGGG - Intergenic
1008595784 6:53040393-53040415 TTTTAGATGCCCACATGGCAAGG + Intronic
1010305105 6:74310589-74310611 CATTAACTGCACAAATTGTACGG - Intergenic
1010489900 6:76462885-76462907 GATTACATGAACACGTTGCAAGG + Intergenic
1010577662 6:77552562-77552584 ATTTAGATGCAGCCATTGCATGG - Intergenic
1010825421 6:80467329-80467351 CATCTGATGCAGACATTTCAGGG + Intergenic
1010877065 6:81120015-81120037 CATCAGAAGCAGACATGGCAGGG - Intergenic
1011513863 6:88130800-88130822 CATAAAATGCACAGATTGCAAGG - Intergenic
1011793019 6:90918469-90918491 CATGCAATGGACACATTGCATGG + Intergenic
1013943220 6:115691238-115691260 CACTATATACACACATTGAAGGG - Intergenic
1015305236 6:131699831-131699853 CTTTAGAGGCTCACTTTGCAAGG + Intronic
1015799865 6:137049361-137049383 CATTTGCTCCTCACATTGCAAGG - Intergenic
1016080066 6:139845104-139845126 CAGATGATGGACACATTGCAGGG + Intergenic
1017980541 6:159397569-159397591 CAATAGATTCACCCAGTGCAGGG - Intergenic
1027971951 7:85094866-85094888 AAGTATAAGCACACATTGCAAGG - Intronic
1031271282 7:119652720-119652742 CATAAGAGGCACTCATTGGAAGG - Intergenic
1033739347 7:144258058-144258080 CTTTAGAGGCTCACTTTGCAAGG + Intergenic
1034526278 7:151665019-151665041 CTACAGATGCACAGATTGCATGG - Intronic
1037594603 8:20344422-20344444 CAGCAGATGCACACCATGCAGGG - Intergenic
1037654458 8:20871279-20871301 CTTTAGACTCACAAATTGCATGG + Intergenic
1037658355 8:20906522-20906544 TATTAGATGCAGGCATTGGAGGG + Intergenic
1039834038 8:41241975-41241997 CATTAGAACCAGACATGGCAGGG - Intergenic
1041422511 8:57683896-57683918 CATTAGAAGAAAACATTTCATGG + Intergenic
1048224736 8:132574359-132574381 AATTGACTGCACACATTGCAAGG - Intronic
1048375143 8:133816702-133816724 CATTAGATGTACAAAATGAAAGG - Intergenic
1051204484 9:14670051-14670073 CTTTGAATTCACACATTGCAAGG + Intronic
1052116959 9:24660615-24660637 CTTTAAATGGATACATTGCATGG - Intergenic
1054542459 9:66279411-66279433 CATTATATTCAAACATTCCAAGG + Intergenic
1055322756 9:75098496-75098518 CTTTATATGCACAGATTCCAAGG + Intronic
1055727921 9:79251327-79251349 GATTAGGTGCACAGATTCCAAGG + Intergenic
1059096833 9:111425751-111425773 AATATGATGCACAAATTGCAGGG + Exonic
1189716039 X:43867153-43867175 CATTTGTAGCAGACATTGCAGGG - Intronic
1191170939 X:57446441-57446463 CATTAAATAGGCACATTGCATGG - Intronic
1192796435 X:74427373-74427395 CATTAGATGCCCACAATCCCTGG + Intronic
1193494522 X:82194713-82194735 CATTAAATGCCCACATTAAAAGG - Intergenic
1195540076 X:106053527-106053549 CAATATATGTATACATTGCATGG - Intergenic
1195756768 X:108206302-108206324 CTTTAGAGGCACAGATTGGATGG + Intronic
1199820571 X:151441744-151441766 CACTAAATGCACATATTGGAAGG - Intergenic