ID: 1169393979

View in Genome Browser
Species Human (GRCh38)
Location 20:5213703-5213725
Sequence AAACTTGCTGTGGCTTCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169393979_1169393983 -6 Left 1169393979 20:5213703-5213725 CCCTAGGAAGCCACAGCAAGTTT No data
Right 1169393983 20:5213720-5213742 AAGTTTTTGCTGATGCTTTAGGG No data
1169393979_1169393984 -1 Left 1169393979 20:5213703-5213725 CCCTAGGAAGCCACAGCAAGTTT No data
Right 1169393984 20:5213725-5213747 TTTGCTGATGCTTTAGGGATAGG No data
1169393979_1169393985 0 Left 1169393979 20:5213703-5213725 CCCTAGGAAGCCACAGCAAGTTT No data
Right 1169393985 20:5213726-5213748 TTGCTGATGCTTTAGGGATAGGG No data
1169393979_1169393982 -7 Left 1169393979 20:5213703-5213725 CCCTAGGAAGCCACAGCAAGTTT No data
Right 1169393982 20:5213719-5213741 CAAGTTTTTGCTGATGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169393979 Original CRISPR AAACTTGCTGTGGCTTCCTA GGG (reversed) Intergenic
No off target data available for this crispr