ID: 1169393982

View in Genome Browser
Species Human (GRCh38)
Location 20:5213719-5213741
Sequence CAAGTTTTTGCTGATGCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169393980_1169393982 -8 Left 1169393980 20:5213704-5213726 CCTAGGAAGCCACAGCAAGTTTT No data
Right 1169393982 20:5213719-5213741 CAAGTTTTTGCTGATGCTTTAGG No data
1169393979_1169393982 -7 Left 1169393979 20:5213703-5213725 CCCTAGGAAGCCACAGCAAGTTT No data
Right 1169393982 20:5213719-5213741 CAAGTTTTTGCTGATGCTTTAGG No data
1169393978_1169393982 2 Left 1169393978 20:5213694-5213716 CCTGTCTGTCCCTAGGAAGCCAC No data
Right 1169393982 20:5213719-5213741 CAAGTTTTTGCTGATGCTTTAGG No data
1169393976_1169393982 6 Left 1169393976 20:5213690-5213712 CCTCCCTGTCTGTCCCTAGGAAG No data
Right 1169393982 20:5213719-5213741 CAAGTTTTTGCTGATGCTTTAGG No data
1169393974_1169393982 14 Left 1169393974 20:5213682-5213704 CCTCTCATCCTCCCTGTCTGTCC No data
Right 1169393982 20:5213719-5213741 CAAGTTTTTGCTGATGCTTTAGG No data
1169393977_1169393982 3 Left 1169393977 20:5213693-5213715 CCCTGTCTGTCCCTAGGAAGCCA No data
Right 1169393982 20:5213719-5213741 CAAGTTTTTGCTGATGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169393982 Original CRISPR CAAGTTTTTGCTGATGCTTT AGG Intergenic
No off target data available for this crispr