ID: 1169393984

View in Genome Browser
Species Human (GRCh38)
Location 20:5213725-5213747
Sequence TTTGCTGATGCTTTAGGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169393980_1169393984 -2 Left 1169393980 20:5213704-5213726 CCTAGGAAGCCACAGCAAGTTTT No data
Right 1169393984 20:5213725-5213747 TTTGCTGATGCTTTAGGGATAGG No data
1169393977_1169393984 9 Left 1169393977 20:5213693-5213715 CCCTGTCTGTCCCTAGGAAGCCA No data
Right 1169393984 20:5213725-5213747 TTTGCTGATGCTTTAGGGATAGG No data
1169393979_1169393984 -1 Left 1169393979 20:5213703-5213725 CCCTAGGAAGCCACAGCAAGTTT No data
Right 1169393984 20:5213725-5213747 TTTGCTGATGCTTTAGGGATAGG No data
1169393976_1169393984 12 Left 1169393976 20:5213690-5213712 CCTCCCTGTCTGTCCCTAGGAAG No data
Right 1169393984 20:5213725-5213747 TTTGCTGATGCTTTAGGGATAGG No data
1169393974_1169393984 20 Left 1169393974 20:5213682-5213704 CCTCTCATCCTCCCTGTCTGTCC No data
Right 1169393984 20:5213725-5213747 TTTGCTGATGCTTTAGGGATAGG No data
1169393978_1169393984 8 Left 1169393978 20:5213694-5213716 CCTGTCTGTCCCTAGGAAGCCAC No data
Right 1169393984 20:5213725-5213747 TTTGCTGATGCTTTAGGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169393984 Original CRISPR TTTGCTGATGCTTTAGGGAT AGG Intergenic
No off target data available for this crispr