ID: 1169394091

View in Genome Browser
Species Human (GRCh38)
Location 20:5214499-5214521
Sequence CAGGATTTCCAGAAGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169394080_1169394091 9 Left 1169394080 20:5214467-5214489 CCCCGGGTAAGACCAGGCACTCT No data
Right 1169394091 20:5214499-5214521 CAGGATTTCCAGAAGGTGCATGG No data
1169394088_1169394091 -3 Left 1169394088 20:5214479-5214501 CCAGGCACTCTGGGTAGGGGCAG No data
Right 1169394091 20:5214499-5214521 CAGGATTTCCAGAAGGTGCATGG No data
1169394082_1169394091 7 Left 1169394082 20:5214469-5214491 CCGGGTAAGACCAGGCACTCTGG No data
Right 1169394091 20:5214499-5214521 CAGGATTTCCAGAAGGTGCATGG No data
1169394076_1169394091 28 Left 1169394076 20:5214448-5214470 CCTGGGGGAAGAGAAATAGCCCC No data
Right 1169394091 20:5214499-5214521 CAGGATTTCCAGAAGGTGCATGG No data
1169394081_1169394091 8 Left 1169394081 20:5214468-5214490 CCCGGGTAAGACCAGGCACTCTG No data
Right 1169394091 20:5214499-5214521 CAGGATTTCCAGAAGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169394091 Original CRISPR CAGGATTTCCAGAAGGTGCA TGG Intergenic
No off target data available for this crispr