ID: 1169394647

View in Genome Browser
Species Human (GRCh38)
Location 20:5218895-5218917
Sequence GGTGGTAGCAAGGGAGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169394647_1169394655 8 Left 1169394647 20:5218895-5218917 CCATTCCCTCCCTTGCTACCACC No data
Right 1169394655 20:5218926-5218948 TGCCACTGTAACCTCACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169394647 Original CRISPR GGTGGTAGCAAGGGAGGGAA TGG (reversed) Intergenic
No off target data available for this crispr