ID: 1169394650

View in Genome Browser
Species Human (GRCh38)
Location 20:5218901-5218923
Sequence TTCCAAGGTGGTAGCAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169394650_1169394659 26 Left 1169394650 20:5218901-5218923 CCTCCCTTGCTACCACCTTGGAA No data
Right 1169394659 20:5218950-5218972 TTATAGTACCTGTTCCTGACTGG No data
1169394650_1169394655 2 Left 1169394650 20:5218901-5218923 CCTCCCTTGCTACCACCTTGGAA No data
Right 1169394655 20:5218926-5218948 TGCCACTGTAACCTCACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169394650 Original CRISPR TTCCAAGGTGGTAGCAAGGG AGG (reversed) Intergenic
No off target data available for this crispr