ID: 1169394652 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:5218905-5218927 |
Sequence | CACATTCCAAGGTGGTAGCA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1169394652_1169394655 | -2 | Left | 1169394652 | 20:5218905-5218927 | CCTTGCTACCACCTTGGAATGTG | No data | ||
Right | 1169394655 | 20:5218926-5218948 | TGCCACTGTAACCTCACCACTGG | No data | ||||
1169394652_1169394659 | 22 | Left | 1169394652 | 20:5218905-5218927 | CCTTGCTACCACCTTGGAATGTG | No data | ||
Right | 1169394659 | 20:5218950-5218972 | TTATAGTACCTGTTCCTGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1169394652 | Original CRISPR | CACATTCCAAGGTGGTAGCA AGG (reversed) | Intergenic | ||