ID: 1169394653

View in Genome Browser
Species Human (GRCh38)
Location 20:5218913-5218935
Sequence TACAGTGGCACATTCCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169394653_1169394655 -10 Left 1169394653 20:5218913-5218935 CCACCTTGGAATGTGCCACTGTA No data
Right 1169394655 20:5218926-5218948 TGCCACTGTAACCTCACCACTGG No data
1169394653_1169394659 14 Left 1169394653 20:5218913-5218935 CCACCTTGGAATGTGCCACTGTA No data
Right 1169394659 20:5218950-5218972 TTATAGTACCTGTTCCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169394653 Original CRISPR TACAGTGGCACATTCCAAGG TGG (reversed) Intergenic
No off target data available for this crispr