ID: 1169394655

View in Genome Browser
Species Human (GRCh38)
Location 20:5218926-5218948
Sequence TGCCACTGTAACCTCACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169394647_1169394655 8 Left 1169394647 20:5218895-5218917 CCATTCCCTCCCTTGCTACCACC No data
Right 1169394655 20:5218926-5218948 TGCCACTGTAACCTCACCACTGG No data
1169394651_1169394655 -1 Left 1169394651 20:5218904-5218926 CCCTTGCTACCACCTTGGAATGT No data
Right 1169394655 20:5218926-5218948 TGCCACTGTAACCTCACCACTGG No data
1169394649_1169394655 3 Left 1169394649 20:5218900-5218922 CCCTCCCTTGCTACCACCTTGGA No data
Right 1169394655 20:5218926-5218948 TGCCACTGTAACCTCACCACTGG No data
1169394650_1169394655 2 Left 1169394650 20:5218901-5218923 CCTCCCTTGCTACCACCTTGGAA No data
Right 1169394655 20:5218926-5218948 TGCCACTGTAACCTCACCACTGG No data
1169394653_1169394655 -10 Left 1169394653 20:5218913-5218935 CCACCTTGGAATGTGCCACTGTA No data
Right 1169394655 20:5218926-5218948 TGCCACTGTAACCTCACCACTGG No data
1169394652_1169394655 -2 Left 1169394652 20:5218905-5218927 CCTTGCTACCACCTTGGAATGTG No data
Right 1169394655 20:5218926-5218948 TGCCACTGTAACCTCACCACTGG No data
1169394646_1169394655 9 Left 1169394646 20:5218894-5218916 CCCATTCCCTCCCTTGCTACCAC No data
Right 1169394655 20:5218926-5218948 TGCCACTGTAACCTCACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169394655 Original CRISPR TGCCACTGTAACCTCACCAC TGG Intergenic
No off target data available for this crispr