ID: 1169394656

View in Genome Browser
Species Human (GRCh38)
Location 20:5218928-5218950
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169394656_1169394659 -1 Left 1169394656 20:5218928-5218950 CCACTGTAACCTCACCACTGGAT No data
Right 1169394659 20:5218950-5218972 TTATAGTACCTGTTCCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169394656 Original CRISPR ATCCAGTGGTGAGGTTACAG TGG (reversed) Intergenic