ID: 1169394657

View in Genome Browser
Species Human (GRCh38)
Location 20:5218937-5218959
Sequence GGTACTATAATCCAGTGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169394657_1169394659 -10 Left 1169394657 20:5218937-5218959 CCTCACCACTGGATTATAGTACC No data
Right 1169394659 20:5218950-5218972 TTATAGTACCTGTTCCTGACTGG No data
1169394657_1169394662 27 Left 1169394657 20:5218937-5218959 CCTCACCACTGGATTATAGTACC No data
Right 1169394662 20:5218987-5219009 TCCCTGTTCCTGTCTTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169394657 Original CRISPR GGTACTATAATCCAGTGGTG AGG (reversed) Intergenic