ID: 1169394659

View in Genome Browser
Species Human (GRCh38)
Location 20:5218950-5218972
Sequence TTATAGTACCTGTTCCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169394654_1169394659 11 Left 1169394654 20:5218916-5218938 CCTTGGAATGTGCCACTGTAACC No data
Right 1169394659 20:5218950-5218972 TTATAGTACCTGTTCCTGACTGG No data
1169394651_1169394659 23 Left 1169394651 20:5218904-5218926 CCCTTGCTACCACCTTGGAATGT No data
Right 1169394659 20:5218950-5218972 TTATAGTACCTGTTCCTGACTGG No data
1169394656_1169394659 -1 Left 1169394656 20:5218928-5218950 CCACTGTAACCTCACCACTGGAT No data
Right 1169394659 20:5218950-5218972 TTATAGTACCTGTTCCTGACTGG No data
1169394650_1169394659 26 Left 1169394650 20:5218901-5218923 CCTCCCTTGCTACCACCTTGGAA No data
Right 1169394659 20:5218950-5218972 TTATAGTACCTGTTCCTGACTGG No data
1169394653_1169394659 14 Left 1169394653 20:5218913-5218935 CCACCTTGGAATGTGCCACTGTA No data
Right 1169394659 20:5218950-5218972 TTATAGTACCTGTTCCTGACTGG No data
1169394657_1169394659 -10 Left 1169394657 20:5218937-5218959 CCTCACCACTGGATTATAGTACC No data
Right 1169394659 20:5218950-5218972 TTATAGTACCTGTTCCTGACTGG No data
1169394652_1169394659 22 Left 1169394652 20:5218905-5218927 CCTTGCTACCACCTTGGAATGTG No data
Right 1169394659 20:5218950-5218972 TTATAGTACCTGTTCCTGACTGG No data
1169394649_1169394659 27 Left 1169394649 20:5218900-5218922 CCCTCCCTTGCTACCACCTTGGA No data
Right 1169394659 20:5218950-5218972 TTATAGTACCTGTTCCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169394659 Original CRISPR TTATAGTACCTGTTCCTGAC TGG Intergenic
No off target data available for this crispr