ID: 1169395328

View in Genome Browser
Species Human (GRCh38)
Location 20:5223995-5224017
Sequence CAGGAACTGCACCACAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169395328_1169395330 -6 Left 1169395328 20:5223995-5224017 CCAGCTCTGTGGTGCAGTTCCTG No data
Right 1169395330 20:5224012-5224034 TTCCTGCTTCGGAGCTAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169395328 Original CRISPR CAGGAACTGCACCACAGAGC TGG (reversed) Intergenic
No off target data available for this crispr