ID: 1169399262

View in Genome Browser
Species Human (GRCh38)
Location 20:5265871-5265893
Sequence GTTCACATGTAGGATGTAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169399259_1169399262 1 Left 1169399259 20:5265847-5265869 CCAGAGGAGGACAAGGGTTGTGG No data
Right 1169399262 20:5265871-5265893 GTTCACATGTAGGATGTAGACGG No data
1169399255_1169399262 16 Left 1169399255 20:5265832-5265854 CCAGAATTCTGGGGGCCAGAGGA No data
Right 1169399262 20:5265871-5265893 GTTCACATGTAGGATGTAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169399262 Original CRISPR GTTCACATGTAGGATGTAGA CGG Intergenic
No off target data available for this crispr