ID: 1169405084

View in Genome Browser
Species Human (GRCh38)
Location 20:5315894-5315916
Sequence GCGCGCGCCCGGGCTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169405075_1169405084 -2 Left 1169405075 20:5315873-5315895 CCCCTAACCCAAGACAAGAGGGC No data
Right 1169405084 20:5315894-5315916 GCGCGCGCCCGGGCTGGGACAGG No data
1169405071_1169405084 3 Left 1169405071 20:5315868-5315890 CCAGCCCCCTAACCCAAGACAAG No data
Right 1169405084 20:5315894-5315916 GCGCGCGCCCGGGCTGGGACAGG No data
1169405069_1169405084 16 Left 1169405069 20:5315855-5315877 CCTCCTCGGCTTTCCAGCCCCCT No data
Right 1169405084 20:5315894-5315916 GCGCGCGCCCGGGCTGGGACAGG No data
1169405079_1169405084 -10 Left 1169405079 20:5315881-5315903 CCAAGACAAGAGGGCGCGCGCCC No data
Right 1169405084 20:5315894-5315916 GCGCGCGCCCGGGCTGGGACAGG No data
1169405076_1169405084 -3 Left 1169405076 20:5315874-5315896 CCCTAACCCAAGACAAGAGGGCG No data
Right 1169405084 20:5315894-5315916 GCGCGCGCCCGGGCTGGGACAGG No data
1169405070_1169405084 13 Left 1169405070 20:5315858-5315880 CCTCGGCTTTCCAGCCCCCTAAC No data
Right 1169405084 20:5315894-5315916 GCGCGCGCCCGGGCTGGGACAGG No data
1169405073_1169405084 -1 Left 1169405073 20:5315872-5315894 CCCCCTAACCCAAGACAAGAGGG No data
Right 1169405084 20:5315894-5315916 GCGCGCGCCCGGGCTGGGACAGG No data
1169405078_1169405084 -9 Left 1169405078 20:5315880-5315902 CCCAAGACAAGAGGGCGCGCGCC No data
Right 1169405084 20:5315894-5315916 GCGCGCGCCCGGGCTGGGACAGG No data
1169405068_1169405084 17 Left 1169405068 20:5315854-5315876 CCCTCCTCGGCTTTCCAGCCCCC No data
Right 1169405084 20:5315894-5315916 GCGCGCGCCCGGGCTGGGACAGG No data
1169405066_1169405084 22 Left 1169405066 20:5315849-5315871 CCTACCCCTCCTCGGCTTTCCAG No data
Right 1169405084 20:5315894-5315916 GCGCGCGCCCGGGCTGGGACAGG No data
1169405067_1169405084 18 Left 1169405067 20:5315853-5315875 CCCCTCCTCGGCTTTCCAGCCCC No data
Right 1169405084 20:5315894-5315916 GCGCGCGCCCGGGCTGGGACAGG No data
1169405077_1169405084 -4 Left 1169405077 20:5315875-5315897 CCTAACCCAAGACAAGAGGGCGC No data
Right 1169405084 20:5315894-5315916 GCGCGCGCCCGGGCTGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169405084 Original CRISPR GCGCGCGCCCGGGCTGGGAC AGG Intergenic
No off target data available for this crispr