ID: 1169410971

View in Genome Browser
Species Human (GRCh38)
Location 20:5370094-5370116
Sequence AAGAATGAGGGGCAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169410971_1169410980 20 Left 1169410971 20:5370094-5370116 CCTGCCTCCTGCCCCTCATTCTT No data
Right 1169410980 20:5370137-5370159 ATCAGAATTCTTTTTCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169410971 Original CRISPR AAGAATGAGGGGCAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr