ID: 1169410980

View in Genome Browser
Species Human (GRCh38)
Location 20:5370137-5370159
Sequence ATCAGAATTCTTTTTCCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169410978_1169410980 -3 Left 1169410978 20:5370117-5370139 CCTGGAAGCAAGCCATAGAAATC No data
Right 1169410980 20:5370137-5370159 ATCAGAATTCTTTTTCCTCAAGG No data
1169410971_1169410980 20 Left 1169410971 20:5370094-5370116 CCTGCCTCCTGCCCCTCATTCTT No data
Right 1169410980 20:5370137-5370159 ATCAGAATTCTTTTTCCTCAAGG No data
1169410974_1169410980 13 Left 1169410974 20:5370101-5370123 CCTGCCCCTCATTCTTCCTGGAA No data
Right 1169410980 20:5370137-5370159 ATCAGAATTCTTTTTCCTCAAGG No data
1169410969_1169410980 24 Left 1169410969 20:5370090-5370112 CCCTCCTGCCTCCTGCCCCTCAT No data
Right 1169410980 20:5370137-5370159 ATCAGAATTCTTTTTCCTCAAGG No data
1169410970_1169410980 23 Left 1169410970 20:5370091-5370113 CCTCCTGCCTCCTGCCCCTCATT No data
Right 1169410980 20:5370137-5370159 ATCAGAATTCTTTTTCCTCAAGG No data
1169410975_1169410980 9 Left 1169410975 20:5370105-5370127 CCCCTCATTCTTCCTGGAAGCAA No data
Right 1169410980 20:5370137-5370159 ATCAGAATTCTTTTTCCTCAAGG No data
1169410972_1169410980 16 Left 1169410972 20:5370098-5370120 CCTCCTGCCCCTCATTCTTCCTG No data
Right 1169410980 20:5370137-5370159 ATCAGAATTCTTTTTCCTCAAGG No data
1169410976_1169410980 8 Left 1169410976 20:5370106-5370128 CCCTCATTCTTCCTGGAAGCAAG No data
Right 1169410980 20:5370137-5370159 ATCAGAATTCTTTTTCCTCAAGG No data
1169410977_1169410980 7 Left 1169410977 20:5370107-5370129 CCTCATTCTTCCTGGAAGCAAGC No data
Right 1169410980 20:5370137-5370159 ATCAGAATTCTTTTTCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169410980 Original CRISPR ATCAGAATTCTTTTTCCTCA AGG Intergenic
No off target data available for this crispr