ID: 1169413189

View in Genome Browser
Species Human (GRCh38)
Location 20:5392260-5392282
Sequence TCAACTATGCAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169413189_1169413195 0 Left 1169413189 20:5392260-5392282 CCCTCTTCCCTCTGCATAGTTGA No data
Right 1169413195 20:5392283-5392305 GGGAAAAACAAATCTCAGAAAGG No data
1169413189_1169413197 29 Left 1169413189 20:5392260-5392282 CCCTCTTCCCTCTGCATAGTTGA No data
Right 1169413197 20:5392312-5392334 CCATTCAGCCAGTAATTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169413189 Original CRISPR TCAACTATGCAGAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr