ID: 1169414248

View in Genome Browser
Species Human (GRCh38)
Location 20:5402479-5402501
Sequence CAATCTCCAAAGGTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169414248_1169414254 1 Left 1169414248 20:5402479-5402501 CCCAGCTCCACCTTTGGAGATTG No data
Right 1169414254 20:5402503-5402525 AATTCAACATGAGATTTGGGTGG 0: 949
1: 10039
2: 14142
3: 11560
4: 8529
1169414248_1169414253 -2 Left 1169414248 20:5402479-5402501 CCCAGCTCCACCTTTGGAGATTG No data
Right 1169414253 20:5402500-5402522 TGCAATTCAACATGAGATTTGGG 0: 63
1: 1548
2: 10218
3: 13819
4: 9903
1169414248_1169414256 3 Left 1169414248 20:5402479-5402501 CCCAGCTCCACCTTTGGAGATTG No data
Right 1169414256 20:5402505-5402527 TTCAACATGAGATTTGGGTGGGG 0: 1001
1: 9794
2: 12757
3: 9934
4: 6663
1169414248_1169414255 2 Left 1169414248 20:5402479-5402501 CCCAGCTCCACCTTTGGAGATTG No data
Right 1169414255 20:5402504-5402526 ATTCAACATGAGATTTGGGTGGG 0: 887
1: 10038
2: 13017
3: 11875
4: 8701
1169414248_1169414252 -3 Left 1169414248 20:5402479-5402501 CCCAGCTCCACCTTTGGAGATTG No data
Right 1169414252 20:5402499-5402521 TTGCAATTCAACATGAGATTTGG 0: 67
1: 1385
2: 5891
3: 15307
4: 14812

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169414248 Original CRISPR CAATCTCCAAAGGTGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr