ID: 1169415904

View in Genome Browser
Species Human (GRCh38)
Location 20:5416029-5416051
Sequence GTTGCAGCCCAGATCCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169415904_1169415906 -9 Left 1169415904 20:5416029-5416051 CCTCCAAGGATCTGGGCTGCAAC No data
Right 1169415906 20:5416043-5416065 GGCTGCAACATCAATTCTCCTGG No data
1169415904_1169415907 -8 Left 1169415904 20:5416029-5416051 CCTCCAAGGATCTGGGCTGCAAC No data
Right 1169415907 20:5416044-5416066 GCTGCAACATCAATTCTCCTGGG No data
1169415904_1169415912 23 Left 1169415904 20:5416029-5416051 CCTCCAAGGATCTGGGCTGCAAC No data
Right 1169415912 20:5416075-5416097 CAGACCTTGCTCTGTGTGGTAGG No data
1169415904_1169415910 19 Left 1169415904 20:5416029-5416051 CCTCCAAGGATCTGGGCTGCAAC No data
Right 1169415910 20:5416071-5416093 CCCACAGACCTTGCTCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169415904 Original CRISPR GTTGCAGCCCAGATCCTTGG AGG (reversed) Intergenic
No off target data available for this crispr